ID: 1045482116

View in Genome Browser
Species Human (GRCh38)
Location 8:102600932-102600954
Sequence GCATCCTAGGGTTAGATTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482116_1045482129 30 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data
1045482116_1045482125 16 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482125 8:102600971-102600993 GGAAACTTCTGCAGGGGCCACGG No data
1045482116_1045482124 10 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data
1045482116_1045482127 26 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482127 8:102600981-102601003 GCAGGGGCCACGGGACAGCGTGG No data
1045482116_1045482128 29 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482128 8:102600984-102601006 GGGGCCACGGGACAGCGTGGAGG No data
1045482116_1045482126 17 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482126 8:102600972-102600994 GAAACTTCTGCAGGGGCCACGGG No data
1045482116_1045482120 -5 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482116_1045482119 -6 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482116_1045482123 9 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482123 8:102600964-102600986 TAAAGCGGGAAACTTCTGCAGGG No data
1045482116_1045482122 8 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482122 8:102600963-102600985 TTAAAGCGGGAAACTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482116 Original CRISPR GCATCCTAGGGTTAGATTTG CGG (reversed) Intergenic
No off target data available for this crispr