ID: 1045482117

View in Genome Browser
Species Human (GRCh38)
Location 8:102600944-102600966
Sequence TTAATAAGAAAGGCATCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482117_1045482129 18 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data
1045482117_1045482128 17 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482128 8:102600984-102601006 GGGGCCACGGGACAGCGTGGAGG No data
1045482117_1045482122 -4 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482122 8:102600963-102600985 TTAAAGCGGGAAACTTCTGCAGG No data
1045482117_1045482126 5 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482126 8:102600972-102600994 GAAACTTCTGCAGGGGCCACGGG No data
1045482117_1045482127 14 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482127 8:102600981-102601003 GCAGGGGCCACGGGACAGCGTGG No data
1045482117_1045482125 4 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482125 8:102600971-102600993 GGAAACTTCTGCAGGGGCCACGG No data
1045482117_1045482123 -3 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482123 8:102600964-102600986 TAAAGCGGGAAACTTCTGCAGGG No data
1045482117_1045482124 -2 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482117 Original CRISPR TTAATAAGAAAGGCATCCTA GGG (reversed) Intergenic
No off target data available for this crispr