ID: 1045482119

View in Genome Browser
Species Human (GRCh38)
Location 8:102600949-102600971
Sequence GGATGCCTTTCTTATTAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482112_1045482119 25 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482114_1045482119 7 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482116_1045482119 -6 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482111_1045482119 29 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482119 Original CRISPR GGATGCCTTTCTTATTAAAG CGG Intergenic
No off target data available for this crispr