ID: 1045482120

View in Genome Browser
Species Human (GRCh38)
Location 8:102600950-102600972
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482111_1045482120 30 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482112_1045482120 26 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482114_1045482120 8 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482116_1045482120 -5 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482120 Original CRISPR GATGCCTTTCTTATTAAAGC GGG Intergenic