ID: 1045482124

View in Genome Browser
Species Human (GRCh38)
Location 8:102600965-102600987
Sequence AAAGCGGGAAACTTCTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482117_1045482124 -2 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data
1045482114_1045482124 23 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data
1045482118_1045482124 -3 Left 1045482118 8:102600945-102600967 CCTAGGATGCCTTTCTTATTAAA No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data
1045482116_1045482124 10 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482124 Original CRISPR AAAGCGGGAAACTTCTGCAG GGG Intergenic
No off target data available for this crispr