ID: 1045482129

View in Genome Browser
Species Human (GRCh38)
Location 8:102600985-102601007
Sequence GGGCCACGGGACAGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482121_1045482129 8 Left 1045482121 8:102600954-102600976 CCTTTCTTATTAAAGCGGGAAAC No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data
1045482116_1045482129 30 Left 1045482116 8:102600932-102600954 CCGCAAATCTAACCCTAGGATGC No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data
1045482117_1045482129 18 Left 1045482117 8:102600944-102600966 CCCTAGGATGCCTTTCTTATTAA No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data
1045482118_1045482129 17 Left 1045482118 8:102600945-102600967 CCTAGGATGCCTTTCTTATTAAA No data
Right 1045482129 8:102600985-102601007 GGGCCACGGGACAGCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482129 Original CRISPR GGGCCACGGGACAGCGTGGA GGG Intergenic
No off target data available for this crispr