ID: 1045485693

View in Genome Browser
Species Human (GRCh38)
Location 8:102629194-102629216
Sequence CAGGTTAATCACTCTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045485693_1045485703 27 Left 1045485693 8:102629194-102629216 CCCCCTTCAGAGTGATTAACCTG No data
Right 1045485703 8:102629244-102629266 CCCTAAGCTCACTGCCTGGCAGG No data
1045485693_1045485701 23 Left 1045485693 8:102629194-102629216 CCCCCTTCAGAGTGATTAACCTG No data
Right 1045485701 8:102629240-102629262 AAAACCCTAAGCTCACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045485693 Original CRISPR CAGGTTAATCACTCTGAAGG GGG (reversed) Intergenic
No off target data available for this crispr