ID: 1045490049

View in Genome Browser
Species Human (GRCh38)
Location 8:102661297-102661319
Sequence TGACACCGTTCCAGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045490044_1045490049 25 Left 1045490044 8:102661249-102661271 CCACCATATGCCAGGTATTAGCT No data
Right 1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG No data
1045490045_1045490049 22 Left 1045490045 8:102661252-102661274 CCATATGCCAGGTATTAGCTGAA No data
Right 1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG No data
1045490043_1045490049 26 Left 1045490043 8:102661248-102661270 CCCACCATATGCCAGGTATTAGC No data
Right 1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG No data
1045490042_1045490049 27 Left 1045490042 8:102661247-102661269 CCCCACCATATGCCAGGTATTAG No data
Right 1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG No data
1045490046_1045490049 15 Left 1045490046 8:102661259-102661281 CCAGGTATTAGCTGAACACTGAG No data
Right 1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045490049 Original CRISPR TGACACCGTTCCAGTGTTGA AGG Intergenic