ID: 1045493817

View in Genome Browser
Species Human (GRCh38)
Location 8:102691194-102691216
Sequence CAGAGGAAACAGATGGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045493813_1045493817 15 Left 1045493813 8:102691156-102691178 CCTTGGCTCTGTTGCTTAGAAGT No data
Right 1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG No data
1045493811_1045493817 17 Left 1045493811 8:102691154-102691176 CCCCTTGGCTCTGTTGCTTAGAA No data
Right 1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG No data
1045493812_1045493817 16 Left 1045493812 8:102691155-102691177 CCCTTGGCTCTGTTGCTTAGAAG No data
Right 1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045493817 Original CRISPR CAGAGGAAACAGATGGGTTG TGG Intergenic
No off target data available for this crispr