ID: 1045496323 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:102712491-102712513 |
| Sequence | TAGTGGGGATGGTGGGCGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045496323_1045496337 | 1 | Left | 1045496323 | 8:102712491-102712513 | CCCCCCGCCCACCATCCCCACTA | No data | ||
| Right | 1045496337 | 8:102712515-102712537 | GGCCCTTTGTGGTTGCAAGATGG | No data | ||||
| 1045496323_1045496340 | 18 | Left | 1045496323 | 8:102712491-102712513 | CCCCCCGCCCACCATCCCCACTA | No data | ||
| Right | 1045496340 | 8:102712532-102712554 | AGATGGCTACCAGAGACAGTTGG | No data | ||||
| 1045496323_1045496333 | -10 | Left | 1045496323 | 8:102712491-102712513 | CCCCCCGCCCACCATCCCCACTA | No data | ||
| Right | 1045496333 | 8:102712504-102712526 | ATCCCCACTAGGGCCCTTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045496323 | Original CRISPR | TAGTGGGGATGGTGGGCGGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||