ID: 1045496323

View in Genome Browser
Species Human (GRCh38)
Location 8:102712491-102712513
Sequence TAGTGGGGATGGTGGGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045496323_1045496337 1 Left 1045496323 8:102712491-102712513 CCCCCCGCCCACCATCCCCACTA No data
Right 1045496337 8:102712515-102712537 GGCCCTTTGTGGTTGCAAGATGG No data
1045496323_1045496340 18 Left 1045496323 8:102712491-102712513 CCCCCCGCCCACCATCCCCACTA No data
Right 1045496340 8:102712532-102712554 AGATGGCTACCAGAGACAGTTGG No data
1045496323_1045496333 -10 Left 1045496323 8:102712491-102712513 CCCCCCGCCCACCATCCCCACTA No data
Right 1045496333 8:102712504-102712526 ATCCCCACTAGGGCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045496323 Original CRISPR TAGTGGGGATGGTGGGCGGG GGG (reversed) Intergenic
No off target data available for this crispr