ID: 1045496953

View in Genome Browser
Species Human (GRCh38)
Location 8:102717120-102717142
Sequence GGATAATTCTTGGTTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045496949_1045496953 3 Left 1045496949 8:102717094-102717116 CCTTGGCTTTATTGACATTTGGG No data
Right 1045496953 8:102717120-102717142 GGATAATTCTTGGTTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045496953 Original CRISPR GGATAATTCTTGGTTACAAC TGG Intergenic
No off target data available for this crispr