ID: 1045499399

View in Genome Browser
Species Human (GRCh38)
Location 8:102733447-102733469
Sequence AGCATGGTTCTGAGCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045499395_1045499399 21 Left 1045499395 8:102733403-102733425 CCAGATGAAAACAGCCAAGCAGC No data
Right 1045499399 8:102733447-102733469 AGCATGGTTCTGAGCTCTGATGG No data
1045499396_1045499399 7 Left 1045499396 8:102733417-102733439 CCAAGCAGCAGCAGCAGCAGCAG No data
Right 1045499399 8:102733447-102733469 AGCATGGTTCTGAGCTCTGATGG No data
1045499394_1045499399 22 Left 1045499394 8:102733402-102733424 CCCAGATGAAAACAGCCAAGCAG No data
Right 1045499399 8:102733447-102733469 AGCATGGTTCTGAGCTCTGATGG No data
1045499393_1045499399 29 Left 1045499393 8:102733395-102733417 CCACTGGCCCAGATGAAAACAGC No data
Right 1045499399 8:102733447-102733469 AGCATGGTTCTGAGCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045499399 Original CRISPR AGCATGGTTCTGAGCTCTGA TGG Intergenic