ID: 1045504531

View in Genome Browser
Species Human (GRCh38)
Location 8:102769179-102769201
Sequence TCTGATTTGAAGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045504531_1045504537 -1 Left 1045504531 8:102769179-102769201 CCATCCTCCTCCTTCAAATCAGA No data
Right 1045504537 8:102769201-102769223 ATCCACACCTGGAACTGGCCTGG No data
1045504531_1045504540 9 Left 1045504531 8:102769179-102769201 CCATCCTCCTCCTTCAAATCAGA No data
Right 1045504540 8:102769211-102769233 GGAACTGGCCTGGAGCTCCCAGG No data
1045504531_1045504536 -6 Left 1045504531 8:102769179-102769201 CCATCCTCCTCCTTCAAATCAGA No data
Right 1045504536 8:102769196-102769218 ATCAGATCCACACCTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045504531 Original CRISPR TCTGATTTGAAGGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr