ID: 1045506624

View in Genome Browser
Species Human (GRCh38)
Location 8:102783149-102783171
Sequence CTGGTTCTCCAGTTCTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045506624_1045506629 4 Left 1045506624 8:102783149-102783171 CCAGTTGAGAACTGGAGAACCAG No data
Right 1045506629 8:102783176-102783198 TGACCTGGTTGTCACAGCTGGGG No data
1045506624_1045506627 2 Left 1045506624 8:102783149-102783171 CCAGTTGAGAACTGGAGAACCAG No data
Right 1045506627 8:102783174-102783196 GCTGACCTGGTTGTCACAGCTGG No data
1045506624_1045506628 3 Left 1045506624 8:102783149-102783171 CCAGTTGAGAACTGGAGAACCAG No data
Right 1045506628 8:102783175-102783197 CTGACCTGGTTGTCACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045506624 Original CRISPR CTGGTTCTCCAGTTCTCAAC TGG (reversed) Intergenic
No off target data available for this crispr