ID: 1045506994

View in Genome Browser
Species Human (GRCh38)
Location 8:102785779-102785801
Sequence CTCCTAAGGAGCCCTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045506986_1045506994 21 Left 1045506986 8:102785735-102785757 CCACCTTCCTGCTGGAGAGTTGC No data
Right 1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG No data
1045506991_1045506994 -1 Left 1045506991 8:102785757-102785779 CCTGGGACTGTTAACAGACCTGC No data
Right 1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG No data
1045506990_1045506994 14 Left 1045506990 8:102785742-102785764 CCTGCTGGAGAGTTGCCTGGGAC No data
Right 1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG No data
1045506987_1045506994 18 Left 1045506987 8:102785738-102785760 CCTTCCTGCTGGAGAGTTGCCTG No data
Right 1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG No data
1045506985_1045506994 22 Left 1045506985 8:102785734-102785756 CCCACCTTCCTGCTGGAGAGTTG No data
Right 1045506994 8:102785779-102785801 CTCCTAAGGAGCCCTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045506994 Original CRISPR CTCCTAAGGAGCCCTGTTCA AGG Intergenic
No off target data available for this crispr