ID: 1045516500

View in Genome Browser
Species Human (GRCh38)
Location 8:102864484-102864506
Sequence CGCAGGCGCCCGAGAGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 1048}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045516500_1045516507 11 Left 1045516500 8:102864484-102864506 CCGCCGCCTCTCGGGCGCCTGCG 0: 1
1: 0
2: 3
3: 38
4: 1048
Right 1045516507 8:102864518-102864540 GGGCCCAGCGCATTGTGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 92
1045516500_1045516505 -9 Left 1045516500 8:102864484-102864506 CCGCCGCCTCTCGGGCGCCTGCG 0: 1
1: 0
2: 3
3: 38
4: 1048
Right 1045516505 8:102864498-102864520 GCGCCTGCGCTCACGCTGCGGGG 0: 2
1: 0
2: 0
3: 5
4: 83
1045516500_1045516508 12 Left 1045516500 8:102864484-102864506 CCGCCGCCTCTCGGGCGCCTGCG 0: 1
1: 0
2: 3
3: 38
4: 1048
Right 1045516508 8:102864519-102864541 GGCCCAGCGCATTGTGAGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 109
1045516500_1045516511 28 Left 1045516500 8:102864484-102864506 CCGCCGCCTCTCGGGCGCCTGCG 0: 1
1: 0
2: 3
3: 38
4: 1048
Right 1045516511 8:102864535-102864557 AGCCGGGTCGAGCTCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1045516500_1045516504 -10 Left 1045516500 8:102864484-102864506 CCGCCGCCTCTCGGGCGCCTGCG 0: 1
1: 0
2: 3
3: 38
4: 1048
Right 1045516504 8:102864497-102864519 GGCGCCTGCGCTCACGCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045516500 Original CRISPR CGCAGGCGCCCGAGAGGCGG CGG (reversed) Exonic
900106771 1:984964-984986 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
900180369 1:1308522-1308544 CGCAGGCGCAAGAGCGGCCGGGG + Intronic
900601859 1:3506147-3506169 GGCAGGCCCCGTAGAGGCGGTGG + Exonic
901285357 1:8074372-8074394 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
901309618 1:8258752-8258774 CCCTGGAGCCCGGGAGGCGGAGG + Intergenic
901482938 1:9538806-9538828 CGCTTGAGCCCGGGAGGCGGGGG - Intergenic
901672406 1:10863504-10863526 TGCAGGCCCACGAGAGTCGGGGG + Intergenic
901902943 1:12382183-12382205 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
901931274 1:12597190-12597212 CCCAGGCACTCGAGAGGCTGAGG - Intronic
902031014 1:13422308-13422330 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
902040686 1:13490240-13490262 CGCTTGAACCCGAGAGGCGGAGG - Intronic
902225015 1:14991269-14991291 CGCTTGAACCCGAGAGGCGGGGG + Intronic
902587410 1:17448924-17448946 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
903075800 1:20765051-20765073 CGCAGCTACCCGGGAGGCGGAGG + Intronic
903291744 1:22318500-22318522 AGCAGGGGCCCCAGGGGCGGTGG + Intergenic
903349924 1:22711212-22711234 CGCGGGCGCCCGGGGAGCGGCGG + Intronic
903455952 1:23486930-23486952 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
903635181 1:24808758-24808780 CGCTTGAACCCGAGAGGCGGAGG - Intronic
903748227 1:25602883-25602905 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
903907100 1:26695502-26695524 CGCAGGCTCCAGAGATGCGCGGG + Intergenic
903912577 1:26738640-26738662 CGCTGGAACCCGGGAGGCGGAGG - Intronic
903923185 1:26815746-26815768 GGCAGGAGCCTGGGAGGCGGAGG + Intergenic
903943726 1:26949022-26949044 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
904114815 1:28153968-28153990 CGCTGGAGCCCGGGAGGCAGAGG + Intronic
904487346 1:30835660-30835682 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
904513580 1:31035307-31035329 CACTTGAGCCCGAGAGGCGGAGG + Intronic
905080404 1:35314366-35314388 CGCTGGAACCCGGGAGGCGGAGG - Intronic
905427951 1:37899095-37899117 CGCTTGAACCCGAGAGGCGGAGG + Intronic
905437553 1:37967774-37967796 CGCTTGCGCCCGGGAGGCAGAGG + Intronic
905512529 1:38533384-38533406 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
905564664 1:38954311-38954333 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
905574439 1:39032073-39032095 CGCTTGAACCCGAGAGGCGGAGG + Intronic
905626294 1:39492182-39492204 CGCGGGCAGCCGGGAGGCGGCGG - Exonic
905670603 1:39788273-39788295 CGCGGGCAGCCGGGAGGCGGCGG + Exonic
905728657 1:40277883-40277905 CGCTGGAACCCGGGAGGCGGAGG + Intronic
905778576 1:40687516-40687538 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
905862634 1:41361475-41361497 CGCTGGAGCCGGAGCGGCGGCGG + Intergenic
906119512 1:43379418-43379440 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
906150140 1:43582813-43582835 AGCAGGCGCCAGGGAGGCCGAGG - Intronic
906342072 1:44988997-44989019 CGCTGGAGCCCAAGAGGCAGAGG + Intergenic
906404618 1:45531830-45531852 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
906508136 1:46395021-46395043 CGCTTGCACCCGGGAGGCGGAGG - Intronic
906540430 1:46581424-46581446 CGCTTGAACCCGAGAGGCGGAGG + Intronic
906973760 1:50546970-50546992 CACTGGAGCCCGTGAGGCGGAGG - Intronic
907012687 1:50978098-50978120 CGCCGGCGGCCGGGAGGCGCCGG - Intergenic
907123405 1:52027914-52027936 CGCTTGAGCCCGAGAGGCGGAGG - Intronic
907304121 1:53504482-53504504 GGCATGAACCCGAGAGGCGGAGG - Intergenic
907389162 1:54145340-54145362 CGCTTGCACCCGGGAGGCGGAGG + Intronic
908142213 1:61197895-61197917 CGCTTGAACCCGAGAGGCGGAGG + Intronic
909354759 1:74695970-74695992 CGCATGAACCCGAGAGGTGGAGG - Intergenic
909610696 1:77548957-77548979 CGCTTGACCCCGAGAGGCGGAGG - Intronic
910186305 1:84544642-84544664 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
910404434 1:86872450-86872472 CGCCTGAACCCGAGAGGCGGAGG - Intronic
910818371 1:91317328-91317350 CGCTTGAACCCGAGAGGCGGAGG + Intronic
910911382 1:92238011-92238033 CACTTGAGCCCGAGAGGCGGAGG - Intronic
911660128 1:100491922-100491944 CGCAGCCACCCGAGAGGAGCTGG + Intronic
912318261 1:108686259-108686281 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
912385459 1:109269132-109269154 CGCAGGCCCCGGAGAGGCCCAGG + Exonic
912434972 1:109655422-109655444 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
912766209 1:112413962-112413984 CGCTGGAACCCGGGAGGCGGAGG + Intronic
912983623 1:114403452-114403474 CGCTTGAACCCGAGAGGCGGAGG - Intronic
913031074 1:114903094-114903116 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
913274167 1:117121703-117121725 CCGAGGCGCGGGAGAGGCGGTGG - Exonic
913671059 1:121097663-121097685 CGCCGGGGCCCGAGAGCAGGCGG - Intergenic
914264655 1:146028040-146028062 GGCAGGCGGCCGGGAGGTGGAGG - Intergenic
914313859 1:146489961-146489983 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
914424287 1:147560521-147560543 CGCTTGAACCCGAGAGGCGGAGG + Intronic
914500491 1:148243419-148243441 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
914665282 1:149827598-149827620 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
914670483 1:149866223-149866245 CGCTTGAACCCGAGAGGCGGAGG - Intronic
914749925 1:150527764-150527786 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
914761499 1:150602498-150602520 CCCAGGAGGCGGAGAGGCGGAGG - Intronic
915135222 1:153727269-153727291 CGCTTGCACCCGGGAGGCGGAGG - Intergenic
915159586 1:153908550-153908572 CGCTGGAACCCGGGAGGCGGAGG - Intronic
915205525 1:154267971-154267993 CGCTTGAACCCGAGAGGCGGAGG - Intronic
915298113 1:154936163-154936185 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
915317953 1:155040217-155040239 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
915590814 1:156869153-156869175 CGCTTGAACCCGAGAGGCGGAGG - Intronic
915831463 1:159134746-159134768 CACTTGAGCCCGAGAGGCGGAGG + Intronic
916228738 1:162517799-162517821 CGCTTGAACCCGAGAGGCGGAGG + Intronic
916242445 1:162653491-162653513 CGCTTGAACCCGAGAGGCGGAGG + Intronic
916390120 1:164321890-164321912 CGCATGAACCCAAGAGGCGGAGG - Intergenic
916800121 1:168208253-168208275 GGCAGGCGGCTGAGAGGTGGAGG + Intergenic
918291636 1:183114151-183114173 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
918343776 1:183589005-183589027 AGCAGGCCCCTGAGAGGAGGTGG + Intronic
919093585 1:193002498-193002520 CGCTTGTGCCCGAGAGGCGGAGG - Intergenic
919682101 1:200445784-200445806 CGCTTGAGCCCAAGAGGCGGAGG - Intergenic
919869620 1:201810620-201810642 CGCTGGGGCCCGAGAGGACGAGG - Exonic
919928605 1:202206999-202207021 CGCTTGAACCCGAGAGGCGGAGG - Intronic
920149165 1:203890389-203890411 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
920155166 1:203943707-203943729 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
920220872 1:204399474-204399496 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
920283126 1:204859059-204859081 CGCTGGCACCCGGGAGGCAGAGG - Intronic
920341819 1:205279882-205279904 CGCATGAACCCGGGAGGCGGAGG + Intergenic
920511750 1:206557085-206557107 CCCAGGCGGCGGGGAGGCGGGGG + Intronic
920712852 1:208311438-208311460 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
920767378 1:208846419-208846441 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
920917081 1:210266374-210266396 GGCATGAACCCGAGAGGCGGAGG + Intergenic
921051787 1:211516260-211516282 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
921089608 1:211830530-211830552 CGCAGGCCCCAGAGCGGCAGCGG - Intronic
921329711 1:214023438-214023460 CGCTGGAGCCCGAGAGGTGGAGG - Intronic
921917263 1:220626736-220626758 CGCTTGCACCCTAGAGGCGGAGG + Intronic
922179818 1:223224951-223224973 CGCATGAGCCTGGGAGGCGGAGG - Intronic
922424856 1:225483328-225483350 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
922506372 1:226128336-226128358 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
922655995 1:227383758-227383780 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
922705613 1:227788624-227788646 GGCAGGAGCCCGGGCGGCGGAGG + Intergenic
922952177 1:229568325-229568347 CACAGGAACCCGAGAGGCAGAGG + Intergenic
923123324 1:231014198-231014220 CGCATGAACCCGGGAGGCGGAGG + Intergenic
923126686 1:231039994-231040016 CGCGGGGGCCCGGGCGGCGGCGG - Exonic
924363729 1:243267516-243267538 CGCTTGAACCCGAGAGGCGGAGG + Intronic
924553695 1:245100966-245100988 CGCTGGAACCCGGGAGGCGGAGG - Intronic
924554460 1:245106958-245106980 CGCTGGAACCCGGGAGGCGGAGG + Intronic
924562031 1:245164985-245165007 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
924728395 1:246690674-246690696 GGCTTGAGCCCGAGAGGCGGAGG + Intergenic
924838226 1:247677157-247677179 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
924857062 1:247884297-247884319 CACTAGCACCCGAGAGGCGGAGG - Intergenic
1062774755 10:135644-135666 CGCCGCCGCCCCAGAGGCCGCGG - Intronic
1063055942 10:2504228-2504250 AGCAGGTGCCCGAGAGGCCCTGG - Intergenic
1063428548 10:5967973-5967995 CACAGGAACCTGAGAGGCGGAGG + Intronic
1063554726 10:7067541-7067563 CGCTGGAGCCCGGGAGGCAGAGG - Intergenic
1063638958 10:7812770-7812792 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1063686797 10:8244699-8244721 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1063744790 10:8868493-8868515 CGCAGGCGCTCGGCAGGCTGAGG - Intergenic
1064398892 10:15004148-15004170 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1065081971 10:22138161-22138183 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1065526085 10:26622532-26622554 CGGCGGCTCCCGGGAGGCGGCGG - Intergenic
1065535249 10:26709475-26709497 CGCATGAACCCGGGAGGCGGAGG + Intronic
1066121901 10:32297363-32297385 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1066287940 10:33986990-33987012 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1067066084 10:43105064-43105086 CGCCGGCGCGCGCGAGGAGGTGG + Exonic
1067444789 10:46334810-46334832 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1067502010 10:46814122-46814144 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1067592577 10:47525886-47525908 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1067639693 10:48033971-48033993 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1067869005 10:49940599-49940621 CGCTGGCATCCGGGAGGCGGAGG - Intronic
1067873804 10:49986334-49986356 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1067984661 10:51129359-51129381 CGCTTGAACCCGAGAGGCGGGGG + Intronic
1068294551 10:55052630-55052652 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1068308073 10:55241130-55241152 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1069222893 10:65906102-65906124 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1069439533 10:68415735-68415757 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1069463731 10:68619311-68619333 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1069477352 10:68746358-68746380 CGCCTGTACCCGAGAGGCGGAGG - Intronic
1069729297 10:70600725-70600747 GGAAGGAGCCCGAGCGGCGGAGG + Exonic
1069951157 10:72019066-72019088 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
1070136668 10:73700075-73700097 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1070356443 10:75645064-75645086 CGCTTGAGCCCAAGAGGCGGAGG - Intronic
1070531018 10:77337534-77337556 CGCTTGAGCCCGAGAGGCGGAGG + Intronic
1070724930 10:78781403-78781425 CGCAGGCCCCCGCGAGGCCCAGG + Intergenic
1071063508 10:81602484-81602506 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1071300996 10:84256150-84256172 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1071489892 10:86129081-86129103 CCCAGGCACCCGAGAGTCTGAGG - Intronic
1071578233 10:86746084-86746106 CGCTGGAGCCAGAGAGGTGGAGG - Intergenic
1071597520 10:86939076-86939098 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1071847574 10:89535828-89535850 CGGAGGCGCCGGCGAGGCTGGGG + Intronic
1071966617 10:90858182-90858204 GGGAGGCGCGGGAGAGGCGGCGG - Intergenic
1072604694 10:96970312-96970334 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1073240414 10:102054303-102054325 CGCTGGAACCCGAGAGACGGAGG + Intronic
1073844898 10:107544317-107544339 CGCTCGCACCCGGGAGGCGGAGG - Intergenic
1074970743 10:118534547-118534569 CGCTTGAGCCCAAGAGGCGGAGG - Intergenic
1075035632 10:119064789-119064811 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1075108645 10:119560077-119560099 GGCAGGCGGCTGAGAGGTGGAGG + Intergenic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1075711055 10:124530662-124530684 CCCAGGGCCCCGAGAGGCAGAGG - Intronic
1075724436 10:124604269-124604291 GGCAGGTGCCCGAGGGTCGGTGG - Intronic
1076209656 10:128629974-128629996 CTCAGGGACCCGAGAGGCAGAGG + Intergenic
1076255580 10:129021951-129021973 CGTATGCTCCTGAGAGGCGGCGG - Intergenic
1076651296 10:131990242-131990264 GGCAGGAACCCGGGAGGCGGAGG + Intergenic
1077027540 11:447896-447918 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1077053904 11:580770-580792 CGCTTGCACCTGAGAGGCGGAGG - Intronic
1077069749 11:663362-663384 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1077253783 11:1571873-1571895 CGGAGGCGCCGGCGGGGCGGGGG - Intronic
1077259573 11:1608689-1608711 CCCAGGAGCCTGGGAGGCGGTGG + Intergenic
1077623259 11:3746827-3746849 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG + Intronic
1078252490 11:9627718-9627740 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1079076543 11:17388494-17388516 CGCTTGAACCCGAGAGGCGGAGG + Exonic
1079213922 11:18489029-18489051 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1079225347 11:18600285-18600307 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1079602714 11:22329168-22329190 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1080433265 11:32217576-32217598 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1080580568 11:33639621-33639643 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1080621176 11:33988452-33988474 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1080924821 11:36745251-36745273 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1081536463 11:44000206-44000228 CGCTTGCACCCGGGAGGCGGAGG - Intergenic
1081983288 11:47283653-47283675 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1081987068 11:47313388-47313410 CCCAGGAGCCCAGGAGGCGGAGG - Intronic
1082064991 11:47892642-47892664 GGCAGGCGGCTGGGAGGCGGAGG - Intergenic
1082076927 11:47981442-47981464 TGCAGGGGCCCGAGGGGCGGCGG + Intronic
1082846842 11:57733337-57733359 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1083237863 11:61363151-61363173 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1083441551 11:62679813-62679835 CGCATGCACCCAGGAGGCGGAGG - Intergenic
1083554187 11:63613325-63613347 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1083557086 11:63638619-63638641 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1083693148 11:64423826-64423848 CACTTGCGCCCGGGAGGCGGAGG + Intergenic
1083931244 11:65846897-65846919 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1083982479 11:66184227-66184249 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1084124325 11:67089059-67089081 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1084379932 11:68805365-68805387 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1084597429 11:70125257-70125279 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1084606310 11:70174310-70174332 CGCATGAACCCGGGAGGCGGAGG + Intronic
1084626168 11:70309251-70309273 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1084737060 11:71112307-71112329 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1084753648 11:71221115-71221137 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1084867920 11:72074948-72074970 CACTTGAGCCCGAGAGGCGGAGG + Intronic
1084969859 11:72765180-72765202 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1085044043 11:73343213-73343235 GGCAGGCTCCCCGGAGGCGGCGG - Intronic
1085197975 11:74683666-74683688 CGCGGGGATCCGAGAGGCGGGGG - Intergenic
1085579150 11:77635433-77635455 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1086204037 11:84237010-84237032 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1086340856 11:85846815-85846837 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1087574325 11:99971457-99971479 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1087785250 11:102347149-102347171 CGAGGGCGCCCGGGAGGCTGGGG - Intergenic
1088027115 11:105198908-105198930 CGCTTGCGCCCAGGAGGCGGAGG + Intergenic
1088083424 11:105948687-105948709 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1088290603 11:108232944-108232966 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1088382095 11:109204561-109204583 CGCTGGAACCTGAGAGGCGGAGG - Intergenic
1090018412 11:123105898-123105920 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1090924076 11:131234369-131234391 CGCAGGCTCCTGAGAGGCAGAGG + Intergenic
1090924536 11:131237697-131237719 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1091459250 12:631445-631467 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1091723344 12:2828756-2828778 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1091947473 12:4561542-4561564 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1092203917 12:6604189-6604211 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1092290570 12:7157583-7157605 CGCCGGCCCCTGAGACGCGGCGG - Exonic
1092804147 12:12203682-12203704 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1092821933 12:12360802-12360824 CACTTGAGCCCGAGAGGCGGAGG - Intronic
1093468386 12:19474874-19474896 CGCTGGAACCCAAGAGGCGGAGG - Intronic
1093972683 12:25389457-25389479 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1094103102 12:26784464-26784486 CGCAGGCACCCGGCAGGCTGAGG - Intronic
1094562829 12:31571699-31571721 CGCTTGAGCCCGAGAGGTGGAGG - Intronic
1094772159 12:33675581-33675603 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1095756387 12:45771272-45771294 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1096313133 12:50539530-50539552 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1096642532 12:53005951-53005973 CGCCTGAACCCGAGAGGCGGGGG + Intergenic
1096732634 12:53626456-53626478 GGAAAGCGGCCGAGAGGCGGGGG + Intergenic
1096820407 12:54229364-54229386 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1097890242 12:64770785-64770807 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1098742202 12:74187362-74187384 CGCTTGAGCCCGAGAGGCGGAGG - Intergenic
1098893339 12:76031464-76031486 CGCAGGAGGCAGAGCGGCGGCGG + Exonic
1098925910 12:76349133-76349155 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1099330457 12:81278455-81278477 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1099395468 12:82133046-82133068 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1099456102 12:82864583-82864605 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1100262606 12:92947308-92947330 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1100418358 12:94402813-94402835 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1100657103 12:96659101-96659123 CGCAGGAACCTGGGAGGCGGAGG - Intronic
1101000012 12:100347933-100347955 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1101149738 12:101873792-101873814 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1101941151 12:109099976-109099998 CGCATGAGCCCAGGAGGCGGAGG + Intronic
1101941493 12:109102392-109102414 CGCTGGATCCCGGGAGGCGGAGG + Intronic
1102073670 12:110042994-110043016 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1102103087 12:110296196-110296218 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1102156353 12:110732311-110732333 CGCCTGCACCCGGGAGGCGGAGG + Intronic
1102170575 12:110839279-110839301 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1102280857 12:111617809-111617831 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1102306395 12:111807958-111807980 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1102367976 12:112355678-112355700 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1102408919 12:112700151-112700173 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1102417185 12:112773999-112774021 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1102534288 12:113569390-113569412 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1102958838 12:117078380-117078402 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1102997445 12:117361198-117361220 CGCGGGCGCCCGGGAGGAAGAGG - Intronic
1103101760 12:118182099-118182121 TGCTGGAACCCGAGAGGCGGAGG + Intronic
1103372619 12:120430887-120430909 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1103397055 12:120616083-120616105 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1103406161 12:120677169-120677191 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1103529411 12:121590146-121590168 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
1103602971 12:122065774-122065796 CGCTTGAGCCCCAGAGGCGGAGG - Intergenic
1103981946 12:124742408-124742430 TGCAGACTCCCGAGGGGCGGTGG + Intergenic
1105241957 13:18616215-18616237 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1105372377 13:19813314-19813336 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1105422213 13:20263171-20263193 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1105557233 13:21458955-21458977 CGCTGGCTCCAGAAAGGCGGCGG + Intronic
1105563390 13:21517691-21517713 CGCTGGAGCCCGGGAGGCAGAGG + Intronic
1105936310 13:25102868-25102890 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1106176874 13:27339407-27339429 CGCATGAGCCCGAGAGGCAGAGG - Intergenic
1106478019 13:30114783-30114805 CGCAGCCGCCCGCGCGGCGGAGG - Intergenic
1106533507 13:30617646-30617668 GGAAAGCGCCCGAGTGGCGGAGG - Intergenic
1107622739 13:42250052-42250074 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1107774966 13:43829387-43829409 CACATGAGCCCGGGAGGCGGAGG - Intronic
1107852080 13:44580589-44580611 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1108054963 13:46476622-46476644 CCCAGGCACCCGGGAGGCTGAGG - Intergenic
1108234494 13:48389074-48389096 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1108781912 13:53846856-53846878 CGCTGGAGCCCATGAGGCGGAGG + Intergenic
1109728921 13:66384746-66384768 CACCGGTGCCCGAGAGGTGGAGG - Intronic
1111169527 13:84507815-84507837 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1111773445 13:92628357-92628379 GGCATGAGCCCGGGAGGCGGAGG - Intronic
1111817992 13:93178771-93178793 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1112010930 13:95293272-95293294 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1112012173 13:95301506-95301528 AGCGGGCGCCCCCGAGGCGGCGG - Intergenic
1112291610 13:98148292-98148314 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1112353732 13:98657400-98657422 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG + Intergenic
1112501034 13:99943325-99943347 GGCATGAGCCCGGGAGGCGGAGG + Intergenic
1112652700 13:101416278-101416300 CGCCGGTGCCCGGGAGGCTGCGG - Intronic
1112749693 13:102569330-102569352 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1113084018 13:106548830-106548852 CGCATGAACCCGGGAGGCGGAGG - Intronic
1113147832 13:107228701-107228723 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1113490908 13:110691097-110691119 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1113774507 13:112935339-112935361 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1113945715 13:114043022-114043044 CGCATGAGCCCGCGAGGCAGAGG - Intronic
1114340090 14:21734114-21734136 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1114525512 14:23365287-23365309 CGGTGGCGCCCGGGAGGCCGCGG - Exonic
1114854621 14:26423512-26423534 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1115556916 14:34551269-34551291 CGCCTGAACCCGAGAGGCGGAGG - Intergenic
1115851297 14:37592314-37592336 CGCAGCCGCGCGGGCGGCGGCGG - Exonic
1116857762 14:49968213-49968235 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1117040901 14:51768071-51768093 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1117478173 14:56118314-56118336 AGCGGGCGCACGAGAGGCTGGGG - Intronic
1117861741 14:60098852-60098874 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1118106330 14:62663985-62664007 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1118170534 14:63384777-63384799 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1118293489 14:64547490-64547512 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1118552742 14:66973673-66973695 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1118651376 14:67899124-67899146 AGCATGAGCCCGGGAGGCGGAGG - Intronic
1118804106 14:69220157-69220179 TGCAGGCGCCAGACAGGAGGAGG - Intronic
1119227150 14:72953082-72953104 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1120572473 14:86138516-86138538 CACTGGAGCCCGGGAGGCGGAGG + Intergenic
1121284287 14:92723128-92723150 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1121417472 14:93788939-93788961 CGCTGGCCCGCGAGAGGCAGCGG + Intergenic
1121450235 14:94002370-94002392 CGCTGGAGCCTGGGAGGCGGAGG - Intergenic
1122083518 14:99283679-99283701 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1122334365 14:100960088-100960110 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1122467823 14:101946421-101946443 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1122606627 14:102950880-102950902 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1122615849 14:103017236-103017258 CGCTGGAGCCCGGGAGGTGGAGG + Intronic
1122711091 14:103658739-103658761 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1122749124 14:103919908-103919930 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1122885953 14:104710395-104710417 TGCACGTGCCCGAGTGGCGGTGG - Intronic
1122992097 14:105241271-105241293 CGCAGAGGCCCGAGGGGCGCCGG + Exonic
1123053207 14:105557471-105557493 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1123077781 14:105677883-105677905 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1123693884 15:22862983-22863005 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
1124201024 15:27678539-27678561 CGCTGGCGCCCCAGAGACTGGGG + Intergenic
1124333032 15:28836736-28836758 CCCAGCAGCCCGAGAGGCTGAGG - Intergenic
1124454116 15:29824357-29824379 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1124912958 15:33940623-33940645 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1125300806 15:38252407-38252429 GGCAGGATCCCGAGAAGCGGCGG - Exonic
1125571857 15:40726333-40726355 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1125682992 15:41544532-41544554 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1126603901 15:50456455-50456477 CCCAGCCACTCGAGAGGCGGAGG + Intronic
1126605866 15:50475684-50475706 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1126799701 15:52287890-52287912 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1126828351 15:52573640-52573662 CGCTGGAACCCGAGAGGCAGAGG - Intergenic
1127466196 15:59247110-59247132 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1127592470 15:60439462-60439484 CGCAAGAGCCTGGGAGGCGGAGG - Intronic
1127618488 15:60710402-60710424 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1128017200 15:64357580-64357602 CGCGGGAACCCGGGAGGCGGAGG + Intronic
1128077958 15:64840276-64840298 CGCTTGAGCCCGAAAGGCGGAGG - Intergenic
1128150887 15:65362936-65362958 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1128346149 15:66853760-66853782 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1128743904 15:70100572-70100594 AGCAGGCGGCCGAGAAGCCGCGG + Intergenic
1129814641 15:78540750-78540772 CGCCGGGGCCCGCGAGGGGGCGG + Intronic
1129846484 15:78770077-78770099 CGCTGGAGCCTGGGAGGCGGAGG + Intronic
1129858746 15:78843923-78843945 CGCTGGAACCCAAGAGGCGGAGG - Intronic
1131033757 15:89207512-89207534 TGCTTGCACCCGAGAGGCGGAGG - Intergenic
1131151688 15:90051153-90051175 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1131281517 15:91025124-91025146 CGCATGAGCCTGGGAGGCGGAGG - Intergenic
1131418559 15:92283448-92283470 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1131475266 15:92733166-92733188 CGCTTGCACCCCAGAGGCGGAGG + Intronic
1131494373 15:92892910-92892932 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1131525651 15:93150448-93150470 CGCTGGAACCCGGGAGGCGGGGG + Intergenic
1132098840 15:99008356-99008378 CGCAGGAGCCCATGACGCGGGGG + Intergenic
1132487703 16:203930-203952 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1132533118 16:463520-463542 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1132712262 16:1274291-1274313 CGCTGGAGCCTGGGAGGCGGAGG - Intergenic
1132783841 16:1643455-1643477 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1133040170 16:3056481-3056503 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1133196486 16:4174400-4174422 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1133196617 16:4175323-4175345 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1133261016 16:4550166-4550188 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1133375121 16:5279583-5279605 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1134132991 16:11662412-11662434 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1134145190 16:11755124-11755146 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1134618961 16:15673291-15673313 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1134620357 16:15684145-15684167 CGCTTGTACCCGAGAGGCGGAGG + Intronic
1134622392 16:15699341-15699363 CGCTGGAGCCCAGGAGGCGGAGG - Intronic
1134878982 16:17727787-17727809 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1135012278 16:18892647-18892669 CACTGGAGCCCGTGAGGCGGAGG + Intronic
1135035908 16:19076673-19076695 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1135088921 16:19496804-19496826 CGCTGGAACCCGAGAGGCGGAGG + Intronic
1135142306 16:19932303-19932325 CGCTGGTACCCGTGAGGCGGAGG - Intergenic
1135319141 16:21479890-21479912 CACTGGAGCCCGTGAGGCGGAGG + Intergenic
1135372037 16:21911683-21911705 CACTGGAGCCCGTGAGGCGGAGG + Intergenic
1135439749 16:22459021-22459043 CACTGGAGCCCGTGAGGCGGAGG - Intergenic
1135773044 16:25232144-25232166 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1136046373 16:27618323-27618345 CGCAGCAGGCTGAGAGGCGGAGG - Intronic
1136366652 16:29812123-29812145 CGGAGGCTCGCGAGGGGCGGGGG + Intronic
1136391922 16:29970858-29970880 CGCTGGAGCCCAGGAGGCGGAGG + Intronic
1136407756 16:30058567-30058589 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1136504525 16:30694475-30694497 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1136848074 16:33592575-33592597 TGCTGGAACCCGAGAGGCGGAGG - Intergenic
1137403655 16:48173706-48173728 CGCATGAGCCCGGGAGGTGGAGG - Intronic
1137417333 16:48295286-48295308 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1137633248 16:49962962-49962984 CGCTTGGACCCGAGAGGCGGAGG + Intergenic
1137996614 16:53222158-53222180 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1138369958 16:56519245-56519267 TGCAGGAACCCGGGAGGCGGAGG + Intronic
1138874588 16:60934276-60934298 CGCTGGAACCCGAGAGGCGGAGG + Intergenic
1139394020 16:66625348-66625370 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1139789178 16:69418734-69418756 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1139928047 16:70502515-70502537 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1140114941 16:72033915-72033937 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1140320095 16:73942340-73942362 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1140512238 16:75516913-75516935 CCCACGAGCCCGGGAGGCGGTGG - Intergenic
1140522297 16:75592276-75592298 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1140606532 16:76545949-76545971 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1140880186 16:79191135-79191157 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1140907451 16:79420948-79420970 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1141076188 16:81008021-81008043 CGCATGAACCCGGGAGGCGGAGG + Intronic
1141103119 16:81212366-81212388 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1141383938 16:83602007-83602029 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1141657566 16:85424247-85424269 CGCTGGCACCGGAGGGGCGGGGG - Intergenic
1141707661 16:85676946-85676968 CGCTTGAACCCGAGAGGCGGAGG - Exonic
1141828046 16:86494720-86494742 CGCAGGCGCCCTAGAGCAGCCGG + Intergenic
1142021945 16:87789307-87789329 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1142081277 16:88150224-88150246 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1203109782 16_KI270728v1_random:1441224-1441246 TGCTGGAACCCGAGAGGCGGAGG - Intergenic
1142509881 17:386407-386429 CGCTGGAGCCCAGGAGGCGGAGG - Intergenic
1142646548 17:1317337-1317359 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1142687903 17:1588300-1588322 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1142702276 17:1670568-1670590 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1142949847 17:3470007-3470029 CGCTTGAGCCCGAGAGGCCGAGG + Intronic
1143025352 17:3938348-3938370 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1143068281 17:4267011-4267033 CGCTTGGGCCCGGGAGGCGGAGG - Intergenic
1143080033 17:4374733-4374755 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1143453805 17:7052978-7053000 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1143494424 17:7303636-7303658 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1143509624 17:7388339-7388361 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1143555713 17:7658572-7658594 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1143658445 17:8310923-8310945 TGCAGGTACCCGAGAGGGGGTGG + Intronic
1143744383 17:8980620-8980642 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1143833597 17:9672078-9672100 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1143901827 17:10180255-10180277 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1144272687 17:13633700-13633722 GGCATGAGCCCGGGAGGCGGAGG - Intergenic
1144550017 17:16232192-16232214 CGCTTGCACCTGAGAGGCGGAGG + Intronic
1144553078 17:16258585-16258607 CGCTTGGGCCCGGGAGGCGGAGG - Intronic
1145031277 17:19507141-19507163 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1145110982 17:20161125-20161147 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1146019816 17:29267980-29268002 CGCTGGAACCCGAGAGGCGGAGG - Intronic
1146216576 17:30981242-30981264 CGCAGGCACTCGACAGGCTGAGG + Intronic
1146238435 17:31189843-31189865 CGCTTGAACCCGAGAGGCGGGGG - Intronic
1146400992 17:32499877-32499899 CGCTGGAGCCTGGGAGGCGGAGG + Intronic
1146793053 17:35763811-35763833 CGCTTGAGCCCGTGAGGCGGAGG + Intronic
1147123979 17:38352818-38352840 CGGAGGGGCCCGGGAGGAGGCGG - Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147203702 17:38821851-38821873 TGCTGGCACCCGGGAGGCGGAGG - Intronic
1147622234 17:41875795-41875817 GGCAGGCGGCCGGGAGGTGGAGG - Intronic
1147629231 17:41919162-41919184 CGCAGGCTCCCAAGAGGCGGTGG - Intronic
1147971314 17:44220113-44220135 CGCAGCCGCCCGGATGGCGGCGG + Intronic
1148431936 17:47649968-47649990 CGCTGGTGCTCGGGAGGCGGAGG - Exonic
1149648753 17:58262471-58262493 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1149897865 17:60444042-60444064 CGCTGGAACCCGGGAGGCGGAGG + Exonic
1151638880 17:75374318-75374340 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1151876311 17:76869688-76869710 CGCAGGCGTCGGAGAGGCGGGGG + Intronic
1151920709 17:77153149-77153171 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1151942534 17:77301506-77301528 CACTTGAGCCCGAGAGGCGGAGG - Intronic
1151994152 17:77598040-77598062 TGGAGGCCCCAGAGAGGCGGCGG - Intergenic
1152197705 17:78926930-78926952 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1152245767 17:79183878-79183900 CGCAGGGGCCCGAGCGTGGGAGG - Intronic
1152343912 17:79740112-79740134 CGCTGGAGCCCGGGAGGTGGAGG + Intronic
1152433545 17:80261931-80261953 CGCTAGAGCCCGGGAGGCGGAGG + Intronic
1152513808 17:80809273-80809295 TGCAGGAACCCGGGAGGCGGAGG - Intronic
1152628603 17:81399646-81399668 CGCGGGCGGCGCAGAGGCGGCGG - Exonic
1152638678 17:81440596-81440618 CCCAGGGTCCCCAGAGGCGGTGG + Intronic
1152725285 17:81942061-81942083 TGCAGGTGCGCGGGAGGCGGAGG - Intronic
1152766740 17:82145461-82145483 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1152848991 17:82620347-82620369 CGCTGGCACCCAGGAGGCGGAGG + Intronic
1152939125 17:83157009-83157031 CGCCTGAACCCGAGAGGCGGAGG - Intergenic
1152977601 18:237980-238002 CCCAGCTGCCCTAGAGGCGGAGG - Intronic
1153101624 18:1477530-1477552 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1153265139 18:3262298-3262320 CGCAGGCGCGCGACGGGAGGGGG - Intronic
1153872910 18:9336306-9336328 CGCATGAACCCGGGAGGCGGAGG + Intronic
1154323354 18:13371679-13371701 CGCCTGAACCCGAGAGGCGGAGG + Intronic
1154446994 18:14443663-14443685 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1154986337 18:21554822-21554844 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1155157637 18:23170878-23170900 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
1155392351 18:25350385-25350407 CGCGGGCGGGCGGGAGGCGGCGG + Intronic
1156648277 18:39194188-39194210 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157649683 18:49315129-49315151 CGCTTAAGCCCGAGAGGCGGAGG + Intronic
1157808383 18:50675398-50675420 CGCATGAACCCGGGAGGCGGAGG - Intronic
1158976217 18:62714112-62714134 CACCTGGGCCCGAGAGGCGGAGG + Intergenic
1159006313 18:63016038-63016060 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1159272138 18:66166695-66166717 CGCATGAACCCGAGAGGCAGAGG + Intergenic
1159643855 18:70894234-70894256 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160617803 18:80147215-80147237 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1160719469 19:590903-590925 CGTGGGCCCCAGAGAGGCGGCGG + Intronic
1160749451 19:727122-727144 TGCAGGCGGCTGTGAGGCGGAGG + Intronic
1160758094 19:768419-768441 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1160761593 19:788156-788178 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1160858723 19:1228742-1228764 CGCACGCGCCCGGCACGCGGCGG + Exonic
1161080598 19:2308168-2308190 CGGCGGAGCCCGGGAGGCGGCGG - Intronic
1161109200 19:2459818-2459840 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1161140029 19:2641743-2641765 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1161409038 19:4106490-4106512 CACATGCACCCGGGAGGCGGAGG - Intronic
1161418648 19:4162891-4162913 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1161461548 19:4400512-4400534 CGCGGGCGCGCGAGCGGCTGAGG - Exonic
1161541831 19:4856472-4856494 CGCTTGAGCCCGAGAGGCGGAGG + Intronic
1161864356 19:6822530-6822552 CGCATGCGCCCGGCAGGCGCTGG - Intronic
1162240467 19:9349027-9349049 CGCTTGACCCCGAGAGGCGGAGG - Intronic
1162404470 19:10465302-10465324 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1162748995 19:12816769-12816791 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1162802177 19:13117635-13117657 CGCTTGCACCCGGGAGGCGGTGG - Intergenic
1163010143 19:14419987-14420009 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1163048338 19:14661814-14661836 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1163307899 19:16493631-16493653 CACATGAACCCGAGAGGCGGAGG - Intronic
1163353071 19:16791795-16791817 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1163740055 19:19006134-19006156 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1164136664 19:22422761-22422783 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1164240902 19:23388160-23388182 TGCTGGAACCCGAGAGGCGGAGG + Intronic
1164275106 19:23710256-23710278 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1165002978 19:32780165-32780187 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1165426669 19:35749719-35749741 CGCTGGAGCCGGGGAGGCGGAGG + Intronic
1165449290 19:35872941-35872963 CGCTGGAGCCCGGGAGGCAGAGG - Intronic
1165471075 19:36004959-36004981 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1165527371 19:36367594-36367616 GGCAGGCGCCCAGGAGGCTGAGG - Intronic
1165534462 19:36431677-36431699 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1165683844 19:37800641-37800663 CGCATGAACCCGAGAGGCGGGGG + Intronic
1165768405 19:38364564-38364586 GGCAGGCGGCTGGGAGGCGGAGG + Intronic
1166103447 19:40585188-40585210 CGCTTGAGCCCGAGTGGCGGAGG - Intronic
1166206053 19:41270064-41270086 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1166310782 19:41961343-41961365 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1166576445 19:43843255-43843277 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1166683154 19:44780554-44780576 CGCTGGAGCCCGGGAGGCAGAGG - Intronic
1166852647 19:45767889-45767911 CTCAGGCGCCCGCGGGGCGCGGG - Intronic
1166996105 19:46720370-46720392 TAGAGGCGCCCTAGAGGCGGCGG - Intronic
1167177691 19:47876991-47877013 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1167321153 19:48797898-48797920 CGCTTGGACCCGAGAGGCGGAGG - Intronic
1167475220 19:49696714-49696736 CGCTGGAGCCCGGGAGGCTGAGG - Intronic
1167585524 19:50372924-50372946 CGCTGGAACCCGTGAGGCGGAGG - Intronic
1167741658 19:51327658-51327680 CGGAGGAGCCTGAGAGTCGGGGG + Intronic
1167743932 19:51340181-51340203 GGCGGGCGGCCGCGAGGCGGCGG + Exonic
1167744030 19:51340583-51340605 CGGACGCGCCCTGGAGGCGGCGG - Exonic
1167874928 19:52404309-52404331 CGCAGGAACCCGGGAGGCGGAGG - Intronic
1167937298 19:52919281-52919303 CGCAGGCGCTCGGCAGGCTGAGG - Intergenic
1167975860 19:53225433-53225455 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1168234493 19:55053538-55053560 CTCAGCCTCCCGAGTGGCGGGGG - Intronic
1168235874 19:55062899-55062921 CGCAGGGGCCGGGAAGGCGGCGG - Intronic
1168272681 19:55258591-55258613 CGCAGGCGCCCGCGGGTCGTGGG + Exonic
1168324778 19:55532682-55532704 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
925400639 2:3569875-3569897 CGCAGGCGCTCGGCAGGCTGAGG + Intergenic
925721156 2:6828874-6828896 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
927479885 2:23444406-23444428 CGCTTGAACCCGAGAGGCGGAGG - Intronic
927528984 2:23776030-23776052 CGCATGAACCCGAGAGACGGAGG + Intronic
927805146 2:26140549-26140571 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
928515746 2:32043385-32043407 CCCATGAGCCCGGGAGGCGGAGG + Intergenic
928607764 2:32959702-32959724 CGCTGGAACCCAAGAGGCGGAGG - Intronic
928904412 2:36355591-36355613 CCCGGCCGCCCGAGAGGGGGAGG + Intergenic
929426141 2:41846613-41846635 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
929432819 2:41902739-41902761 CGCTTGAGCCCGAGAGGTGGAGG + Intergenic
929648798 2:43656933-43656955 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
930120982 2:47760667-47760689 CGCTTGAACCCGAGAGGCGGAGG - Intronic
930258698 2:49120185-49120207 CGCCGGGGCCAGAGAGGCGAAGG + Intronic
930671293 2:54153713-54153735 CCCAGGCACTCGAGAGGCTGAGG - Intronic
930814595 2:55581167-55581189 CGCTTGAACCCGAGAGGCGGAGG + Intronic
931393013 2:61860897-61860919 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
931423566 2:62150454-62150476 TGCTGGAGCCCGAGAGGCGGAGG + Intergenic
932016447 2:68032560-68032582 CGCTGGAGCCCAGGAGGCGGAGG + Intergenic
932179365 2:69631894-69631916 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
932223636 2:70021784-70021806 CGCATGAACCCGGGAGGCGGAGG - Intergenic
932555084 2:72816073-72816095 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
932754222 2:74394729-74394751 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
933735695 2:85492162-85492184 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
934101099 2:88653762-88653784 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
934558591 2:95300560-95300582 GGCAGGAGCCTGAGAGTCGGGGG + Intronic
935027184 2:99288650-99288672 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
935040020 2:99417221-99417243 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
935117040 2:100145651-100145673 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
935201320 2:100859177-100859199 CGCCTGAACCCGAGAGGCGGAGG + Intronic
936009414 2:108915811-108915833 CGCTGGAACCCGGGAGGCGGAGG + Intronic
936320332 2:111461590-111461612 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
936453336 2:112650414-112650436 TGCTTGAGCCCGAGAGGCGGAGG - Intronic
936592969 2:113821188-113821210 CACTGGAACCCGAGAGGCGGAGG - Intergenic
936878440 2:117220658-117220680 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
938305749 2:130253048-130253070 TGCGGGCGCCCGAGGAGCGGGGG + Intergenic
938310911 2:130287582-130287604 CGCAGGAGCCTGGGAGGCCGAGG + Intergenic
938337229 2:130510814-130510836 CGCTTGATCCCGAGAGGCGGAGG + Intergenic
938352608 2:130609917-130609939 CGCTTGATCCCGAGAGGCGGAGG - Intergenic
938881687 2:135596080-135596102 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
940207835 2:151223747-151223769 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
940223618 2:151379014-151379036 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
940227134 2:151411484-151411506 CGCTTGAACCCGAGAGGCGGAGG - Intronic
940265158 2:151828450-151828472 CGCAGCCGCCCGAGAGGAGCTGG - Exonic
940297415 2:152141672-152141694 CGCTGGAACCCGGGAGGCGGAGG - Intronic
940388331 2:153100943-153100965 CGCTGGAACCCGAGAGGCAGAGG + Intergenic
940776223 2:157886651-157886673 CGCAGGAGGCTGAGAGGCTGAGG + Intronic
940870751 2:158858258-158858280 CGCTGGAACCCGGGAGGCGGAGG + Intronic
941021401 2:160410825-160410847 CGCTGGAACCCGAGAGGCAGAGG - Intronic
941951492 2:171160827-171160849 CGGCGTCGCCCGGGAGGCGGCGG + Exonic
942377643 2:175353769-175353791 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
942541837 2:177022733-177022755 CGCTTGCACCCCAGAGGCGGAGG + Intergenic
943329645 2:186543434-186543456 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
944456089 2:199896099-199896121 TGCATGAACCCGAGAGGCGGAGG + Intergenic
944546821 2:200807115-200807137 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
944585223 2:201166609-201166631 GGCAGGCGGCTGGGAGGCGGAGG + Exonic
944700880 2:202245159-202245181 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
944738809 2:202591870-202591892 CCCAGCTGCCCGAGAGGCTGAGG + Intergenic
944966552 2:204941288-204941310 CGCTGGAGCCCGGAAGGCGGAGG + Intronic
945242432 2:207688263-207688285 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
945473026 2:210249327-210249349 CGCCTGCACCCGGGAGGCGGAGG - Intergenic
946265718 2:218539629-218539651 CGCCTGAGCCCGGGAGGCGGAGG + Intronic
946279746 2:218658455-218658477 CGCTGGAACCCGGGAGGCGGAGG + Intronic
946324666 2:218979007-218979029 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
946595455 2:221301207-221301229 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
946692511 2:222319933-222319955 CGCAGGAGCCCGGGACGCAGCGG - Intergenic
947138228 2:226996041-226996063 CGCAGGGGCCCGAGGAGCTGAGG - Exonic
947289296 2:228554251-228554273 CGCTGGAGCCCGGGAGGTGGAGG + Intergenic
947719885 2:232363834-232363856 CGCAGGGCCCCGGGAGGCAGGGG - Intergenic
947731453 2:232433699-232433721 CGCAGGGCCCCGGGAGGCAGGGG - Intergenic
948160119 2:235816352-235816374 CGCATGAACCCGGGAGGCGGAGG + Intronic
948402291 2:237692608-237692630 CGCAGGTGCCCGGGAGGCGTGGG + Intronic
948419996 2:237852294-237852316 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
948576655 2:238956046-238956068 CGCAGGAGCTCTGGAGGCGGAGG + Intergenic
1169044736 20:2526201-2526223 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1169217208 20:3800789-3800811 CCCAGGCGCCCGACGGCCGGAGG + Exonic
1170544565 20:17424574-17424596 CGCATGAACCAGAGAGGCGGAGG - Intronic
1170562150 20:17567775-17567797 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1170756795 20:19212468-19212490 CGGGGGCGGCCGGGAGGCGGGGG - Intergenic
1170937942 20:20825848-20825870 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1172019788 20:31905947-31905969 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1172679038 20:36697622-36697644 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1172770542 20:37379810-37379832 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1172867056 20:38108305-38108327 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1173026090 20:39308828-39308850 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1173243430 20:41317597-41317619 CGCAGGCCCCGCAGAGGCGGCGG + Intronic
1173814921 20:45981086-45981108 CGCCTGAGCCTGAGAGGCGGAGG - Intergenic
1174483439 20:50846695-50846717 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1174599712 20:51714463-51714485 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1176133914 20:63511058-63511080 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1177215718 21:18125677-18125699 CGCATGAACCCGTGAGGCGGAGG - Intronic
1177526594 21:22299938-22299960 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
1177989680 21:28021874-28021896 CGCTTGAACCCGAGAGGCGGGGG + Intergenic
1178573281 21:33761157-33761179 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1178610367 21:34073932-34073954 CGCGTGCGCGCGGGAGGCGGGGG + Intronic
1178759011 21:35382454-35382476 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1178981045 21:37265999-37266021 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1178992483 21:37367205-37367227 CGCCGGGGCCCGGGCGGCGGCGG - Intronic
1179567059 21:42255819-42255841 CCCAGGAGCCCGAGAGGCCACGG - Intronic
1179679578 21:43009359-43009381 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1179807199 21:43847128-43847150 TGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1179979276 21:44887981-44888003 CACAGGCTCCTGAGAGGCAGAGG - Intronic
1180241001 21:46505523-46505545 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1180791761 22:18578549-18578571 CGCGGGGGCCCGAGGGGCGCTGG - Intergenic
1180912308 22:19459820-19459842 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1180943106 22:19673001-19673023 CGCTGGAACCCGAGAGGCAGAGG - Intergenic
1181081510 22:20418696-20418718 CGCTGGAGCCCGGGAGGCGGAGG + Intergenic
1181180410 22:21063889-21063911 CGCTGGAGCCCGAGAGGTGGAGG + Intronic
1181183911 22:21087961-21087983 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1181229975 22:21416760-21416782 CGCGGGGGCCCGAGGGGCGCTGG + Intergenic
1181248674 22:21518106-21518128 CGCGGGGGCCCGAGGGGCGCTGG - Intergenic
1181569730 22:23761787-23761809 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1181719547 22:24763382-24763404 CGCTGGAGCCCGGGAGGCGGAGG - Intronic
1181925661 22:26356556-26356578 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1182278794 22:29206359-29206381 CCCAGGAGCTCGAGAGGAGGGGG + Intronic
1183525919 22:38322653-38322675 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1183637669 22:39074563-39074585 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1183892861 22:40945200-40945222 CCCAGGTACCCGAGAGGCAGAGG - Intergenic
1184212863 22:43046751-43046773 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1184440577 22:44510394-44510416 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1184485712 22:44777777-44777799 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1184523862 22:45010070-45010092 CGCAGGCGCGGGCGGGGCGGGGG - Intergenic
1184796821 22:46737859-46737881 CGCAGGCGCCAGGGAGGGGTCGG - Intronic
1185361379 22:50409509-50409531 CGCTGGAACCCGGGAGGCGGAGG - Intronic
949190989 3:1248734-1248756 CGCTTGAACCCGAGAGGCGGAGG + Intronic
949495784 3:4630667-4630689 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
950282635 3:11720313-11720335 CGACGGGGCCCGGGAGGCGGGGG - Intronic
950384976 3:12651548-12651570 CGCTGGAACCCGGGAGGCGGGGG + Intronic
951213314 3:19999463-19999485 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
951216385 3:20029421-20029443 CCCTTGAGCCCGAGAGGCGGAGG - Intergenic
951559614 3:23952640-23952662 CGCATGAACCCGGGAGGCGGAGG + Intronic
951637653 3:24797668-24797690 CGCAGTCGCAGGAGAGGCAGAGG + Intergenic
952168297 3:30776000-30776022 CGCTTGAACCCGAGAGGCGGAGG + Intronic
952392120 3:32889670-32889692 CGCTTGAACCCGAGAGGCGGAGG - Intronic
953518551 3:43620679-43620701 CGCTTGAACCCGAGAGGCGGAGG + Intronic
954255525 3:49402951-49402973 CGCTTGAACCCGAGAGGCGGAGG + Intronic
954264927 3:49464501-49464523 CGCTTGGGCCCGGGAGGCGGAGG + Intergenic
954444494 3:50539548-50539570 CGGAGGAGCCCGGGAGACGGGGG + Intergenic
955055557 3:55452309-55452331 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
955292723 3:57707342-57707364 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
955561137 3:60192165-60192187 CGCTCGAGCCCGGGAGGCGGAGG + Intronic
955771497 3:62389325-62389347 CGCGTGAACCCGAGAGGCGGAGG - Intergenic
956295285 3:67705354-67705376 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
956468642 3:69542628-69542650 CCCAGCCCCCGGAGAGGCGGCGG - Intergenic
956574908 3:70741568-70741590 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
957342726 3:78921868-78921890 CGCTTGAACCCGAGAGGCGGAGG - Intronic
958809362 3:98841979-98842001 CGCTTGAACCCGAGAGGCGGAGG + Intronic
960377828 3:116925171-116925193 CGCTTGAACCCGAGAGGCGGAGG - Intronic
960848018 3:122022318-122022340 CGCAGTCCCCCGGGAGGCGGGGG - Intergenic
961017032 3:123476304-123476326 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
961259087 3:125585212-125585234 CGCATGAGCCCCAGAGGCGAAGG - Intronic
961273468 3:125708039-125708061 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
962124342 3:132599421-132599443 CGCATGAACCCGGGAGGCGGAGG + Intronic
962164845 3:133038333-133038355 CGCGGGGGCCCGAGGGGCGAAGG + Intergenic
963160782 3:142149254-142149276 CGCGGGCGCCACAGAAGCGGCGG - Exonic
963200503 3:142581201-142581223 CGCTTGACCCCGAGAGGCGGAGG + Intergenic
963214409 3:142728394-142728416 CGCTGGAACCCGGGAGGCGGAGG - Intronic
963502940 3:146151411-146151433 CGCTTGAACCCGAGAGGCGGAGG + Intronic
963780799 3:149484465-149484487 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
964121952 3:153194371-153194393 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
964215634 3:154278558-154278580 CGCCGGAACCCGGGAGGCGGAGG - Intronic
964354757 3:155840169-155840191 CGCTGGAACCCGGGAGGCGGAGG - Intronic
964794411 3:160481614-160481636 CGCAGGAACCCGGGAGGCAGGGG + Intronic
965427611 3:168546700-168546722 CACTTGAGCCCGAGAGGCGGAGG - Intergenic
965582408 3:170283019-170283041 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
966546628 3:181156857-181156879 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
966757274 3:183383316-183383338 CGCTTGAACCCGAGAGGCGGAGG - Intronic
966782144 3:183593095-183593117 AGCAGGAGCCAGAGAGGGGGCGG - Intergenic
966814024 3:183874490-183874512 CGCTTGCACCCGAGAGGTGGAGG - Intronic
966820739 3:183922286-183922308 CGCTGGAACCCGGGAGGCGGAGG + Intronic
966843511 3:184107749-184107771 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
966866503 3:184261446-184261468 CCCAGCGGCCCGGGAGGCGGAGG - Exonic
966926766 3:184649362-184649384 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
966967028 3:185004122-185004144 GGCAGGCGGCCGGGAGGTGGAGG + Intronic
967795814 3:193597605-193597627 CGCTTGAGCCCCAGAGGCGGAGG + Intronic
967858277 3:194134355-194134377 GGCGGGCGCCCGGGAGGAGGCGG - Intergenic
968092108 3:195905281-195905303 CGCATGAACCCGGGAGGCGGAGG - Intronic
968150263 3:196332328-196332350 CGCTTGAGCCCGAGAGGCAGAGG + Intronic
968165995 3:196465832-196465854 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
968236750 3:197036374-197036396 GGCAGGAACCCGGGAGGCGGAGG - Intergenic
968259175 3:197305609-197305631 CGCATGAACCCGGGAGGCGGAGG + Intergenic
968332551 3:197884236-197884258 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
968354677 3:198095759-198095781 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
968484758 4:853879-853901 CGCTGGAACCCGGGAGGCGGAGG - Intronic
969018573 4:4122606-4122628 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
969186082 4:5475339-5475361 CGCTTGAACCCGAGAGGCGGAGG + Intronic
969441098 4:7217226-7217248 GGCAAGCGCCAGAAAGGCGGGGG - Intronic
969713711 4:8858616-8858638 CGCAGGCCCCCGGGCGGCCGGGG + Intronic
969755878 4:9150364-9150386 CGCTGGAGCCCGGGAGGCAGAGG + Intergenic
969816205 4:9689522-9689544 CGCTGGAGCCCGGGAGGCAGAGG + Intergenic
970616915 4:17776470-17776492 CGCTTGAACCCGAGAGGCGGAGG - Intronic
971342202 4:25780939-25780961 CTCAGGCACTCGAGAGGCTGAGG - Intronic
971757135 4:30719834-30719856 CGCTGCAGCCCGAGGGGCGGCGG + Intergenic
972313874 4:37907462-37907484 CGCTTGAACCCGAGAGGCGGAGG - Intronic
972564874 4:40260671-40260693 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
972620959 4:40748329-40748351 GGCATGAACCCGAGAGGCGGAGG - Intergenic
972658692 4:41092603-41092625 CGCTTGAACCCGAGAGGCGGAGG + Intronic
972761203 4:42106300-42106322 GGCATGAGCCCGGGAGGCGGAGG - Intergenic
972811147 4:42587389-42587411 CGCTTGAACCCGAGAGGCGGAGG - Intronic
973199806 4:47487143-47487165 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
973243083 4:47979235-47979257 CGCTTGAGCCCAAGAGGCGGAGG + Intronic
973632877 4:52835715-52835737 CGCTGGAACCCGAGAGGCAGAGG + Intergenic
973817623 4:54632817-54632839 CACAGGAGCCCAAGGGGCGGAGG - Intergenic
973841405 4:54864707-54864729 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
974875718 4:67700944-67700966 TGGGGGCGCCCGAGAGGCCGCGG - Intronic
975122703 4:70746258-70746280 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
976920693 4:90439202-90439224 CACTGGAGCCCGGGAGGCGGAGG + Intronic
977226935 4:94403387-94403409 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
977536486 4:98261100-98261122 GGCGGCCGCCTGAGAGGCGGAGG - Intergenic
977636666 4:99306087-99306109 CGCTGGAGCCTGGGAGGCGGAGG - Exonic
977810091 4:101347597-101347619 TGCAGGCGCGCAAGAGGCGGGGG - Intronic
977865878 4:102026736-102026758 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
978051180 4:104202265-104202287 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
978387511 4:108190790-108190812 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
979273632 4:118791877-118791899 GGCAGGCGCCTGGGAGGTGGAGG - Intronic
979534782 4:121807204-121807226 CGCATGAGCCCAGGAGGCGGAGG + Intronic
980650976 4:135714119-135714141 CGCATGAACCCGGGAGGCGGAGG + Intergenic
980921826 4:139093980-139094002 CGCTCGAACCCGAGAGGCGGAGG - Intronic
980929671 4:139173672-139173694 CGCTTGAACCCGAGAGGCGGAGG + Intronic
980930682 4:139179477-139179499 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
981475702 4:145184583-145184605 CGCTGGAAACCGAGAGGCGGAGG + Intergenic
981967122 4:150617556-150617578 CGCTTGAACCCGAGAGGCGGAGG + Intronic
982000563 4:151017356-151017378 CGCTGGAGCCCGGGAGGCAGAGG - Intergenic
982002525 4:151034073-151034095 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
982135979 4:152274635-152274657 CGCTTGAGCCCGAGAGGTGGAGG - Intergenic
982161768 4:152577445-152577467 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
982745884 4:159103666-159103688 CGCAAGCCCCTGAGAGGAGGGGG + Intergenic
982766778 4:159357597-159357619 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
983435728 4:167712792-167712814 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
983505835 4:168552757-168552779 CGCATGAGCCCGGGAGGCAGAGG - Intronic
983526069 4:168761542-168761564 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
983578669 4:169285989-169286011 CGCTGGAGCCCGGGAGGCAGAGG - Intergenic
983780252 4:171661683-171661705 CGCCTGAACCCGAGAGGCGGAGG + Intergenic
984667038 4:182440194-182440216 CGCTTGAACCCGAGAGGCGGAGG - Intronic
985022700 4:185709099-185709121 CGCTTGAACCCGAGAGGCGGAGG - Intronic
985342276 4:188967844-188967866 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
985387495 4:189462931-189462953 GGCAGGATCCCGAGAGGTGGAGG - Intergenic
985615023 5:915040-915062 GGGAGGTGCCGGAGAGGCGGGGG + Intronic
986321348 5:6634241-6634263 CGCTTGAACCCGAGAGGCGGAGG + Intronic
986560570 5:9056636-9056658 CGCAGGAACCTGTGAGGCGGAGG + Intronic
986849843 5:11798176-11798198 CGCTGGAACCCGGGAGGCGGAGG + Intronic
986893880 5:12341869-12341891 CGCATGAACCCGGGAGGCGGAGG - Intergenic
987050378 5:14143465-14143487 GGCCGGCGCCCGGGAGGCCGTGG + Intergenic
987059522 5:14228785-14228807 CGCTTGAACCCGAGAGGCGGAGG + Intronic
987633210 5:20503952-20503974 CGCTTGAACCCGAGAGGCGGAGG + Intronic
988943254 5:36167731-36167753 CCCAGGTGCTCGAGAGGCTGAGG - Intronic
989377824 5:40783673-40783695 CGCTTGAACCCGAGAGGCGGAGG + Intronic
989405614 5:41057638-41057660 CGCTTGAACCCGAGAGGCGGAGG - Intronic
990826137 5:59900121-59900143 CTCAGGCTCCAGAGAGGCTGGGG - Intronic
990846501 5:60146128-60146150 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
991053824 5:62301019-62301041 CGCTTGAGCCCCAGAGGCGGAGG + Intergenic
991391542 5:66149264-66149286 CGCATGAACCCGGGAGGCGGAGG + Intronic
991617624 5:68513494-68513516 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
991900457 5:71455115-71455137 CGCCTGAGCCCGAGAGGTGGAGG + Intergenic
992395927 5:76369662-76369684 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
992473263 5:77077754-77077776 CCCAGGCGGCCGGGAGGCGTCGG + Exonic
992674847 5:79095675-79095697 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
992682549 5:79167317-79167339 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
992779201 5:80112846-80112868 CACAGGTGCTCGAGAGGCTGAGG + Intronic
993719740 5:91310705-91310727 CGCTGGAACCCGAGAGGCGGAGG - Intergenic
994068486 5:95570863-95570885 CGCTGGAACCCGGGAGGCGGAGG - Intronic
994099967 5:95881424-95881446 CGCATGAACCCGGGAGGCGGAGG + Intergenic
995491751 5:112700231-112700253 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
996048164 5:118899883-118899905 CGCTTGAACCCGAGAGGCGGAGG - Intronic
997525934 5:134553435-134553457 CGCATGAACCCGGGAGGCGGAGG - Intronic
998059933 5:139111958-139111980 CGCAGGCGCTCGGCAGGCTGAGG - Intronic
998083897 5:139300279-139300301 CACGGGAACCCGAGAGGCGGAGG + Intronic
998108782 5:139485345-139485367 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
998419261 5:141969002-141969024 GGGAGGCGCCCGAGAGGCAGGGG + Intronic
998510211 5:142706905-142706927 CCCAGGCTCCCAGGAGGCGGAGG - Intergenic
998750387 5:145315151-145315173 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
999344569 5:150804752-150804774 CACTGGAACCCGAGAGGCGGAGG + Intergenic
1000655633 5:163875074-163875096 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1000665218 5:163986435-163986457 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
1000953579 5:167514925-167514947 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1001064300 5:168523826-168523848 CGCTTGAGCCCGAGAGGTGGAGG - Intergenic
1001391922 5:171386502-171386524 CTCGGGAGCCCGGGAGGCGGAGG + Intergenic
1002047312 5:176549364-176549386 GGCAGGCGCCGGACAGGCGCTGG - Intronic
1002280589 5:178127836-178127858 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1002708835 5:181181851-181181873 CGCAGGAGCCCCAGAGGTGGAGG - Intergenic
1003245494 6:4378724-4378746 CCCAGGAGCCCAAGAGGAGGAGG + Intergenic
1003319611 6:5038759-5038781 CGCAGGCACCCGGCAGGCTGAGG + Intergenic
1005071417 6:21865797-21865819 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1005479241 6:26239944-26239966 CGCTCGAACCCGAGAGGCGGAGG + Intergenic
1005569539 6:27131668-27131690 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1005578893 6:27214992-27215014 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1005634407 6:27739648-27739670 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1005733347 6:28720680-28720702 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1005743366 6:28813638-28813660 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1005825999 6:29632331-29632353 CGCCCGCGCCCGGGGGGCGGAGG + Exonic
1005930099 6:30476768-30476790 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1006033263 6:31193211-31193233 CGCTGGAGCCCGGGAGGTGGAGG - Intergenic
1006558031 6:34886042-34886064 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1006654663 6:35580620-35580642 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1006711802 6:36080025-36080047 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1006932547 6:37696842-37696864 CGGCGCAGCCCGAGAGGCGGCGG + Exonic
1007378226 6:41470590-41470612 CGCTGGCGCCCCGGAGACGGCGG - Intergenic
1007467830 6:42067300-42067322 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1007653991 6:43441017-43441039 TGCATGAACCCGAGAGGCGGAGG + Intronic
1007900497 6:45407185-45407207 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1008542483 6:52557107-52557129 CGCATGGGCCTGGGAGGCGGAGG + Intronic
1008611431 6:53187877-53187899 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1008939430 6:57030283-57030305 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1009010389 6:57835071-57835093 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1010179281 6:73066060-73066082 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1010300727 6:74255607-74255629 CGCAGGCGGCTGGGAGGTGGAGG + Intergenic
1010426937 6:75738509-75738531 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1010703131 6:79077112-79077134 CGGGGGCGCGCGAGAGTCGGCGG - Intronic
1010794881 6:80106942-80106964 CGCAGGCGCCCGCGAGGGGCAGG + Intronic
1011119744 6:83938916-83938938 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1011267308 6:85535519-85535541 GGCAGGAGCCCGGGAGGCGGAGG + Intronic
1011440320 6:87380533-87380555 CGCTTGAGCCCGAGAGGCGGAGG - Intronic
1011689768 6:89856497-89856519 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
1011695347 6:89907453-89907475 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1012211282 6:96521724-96521746 CGCTTGCGCCCGAGGCGCGGGGG - Intronic
1013153694 6:107472269-107472291 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1013239768 6:108233663-108233685 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1013506998 6:110810688-110810710 CGCTGGAACCCAAGAGGCGGAGG + Intronic
1013657418 6:112260048-112260070 CGCTGGAACCCAAGAGGCGGAGG + Intergenic
1014116965 6:117676492-117676514 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1014431874 6:121380640-121380662 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1014442333 6:121487973-121487995 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1015393948 6:132714649-132714671 CACATGAACCCGAGAGGCGGAGG - Intergenic
1015515746 6:134081161-134081183 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1015612125 6:135034558-135034580 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1015980075 6:138829804-138829826 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1016003052 6:139061968-139061990 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1016763202 6:147763241-147763263 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1016823440 6:148367053-148367075 GGCAGGCGCCTGGGAGGCAGAGG - Intronic
1016883934 6:148940408-148940430 CGCATGAGCCCGGGAGACGGAGG + Intronic
1016947290 6:149546573-149546595 CGCTGGAGCCCGGGAGGTGGAGG - Intergenic
1016957525 6:149640952-149640974 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1017861590 6:158403421-158403443 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1018010869 6:159668501-159668523 CGCTGGAACCTGAGAGGCGGAGG + Intergenic
1018413253 6:163577656-163577678 CACAGGAGCCAGAGAGCCGGGGG - Exonic
1018857948 6:167688878-167688900 CACTGGAACCCGAGAGGCGGAGG + Intergenic
1019010381 6:168839853-168839875 CACAGGCGTCTGAGAGACGGGGG + Intergenic
1019217534 6:170453447-170453469 CCAAGGGGCCCGAGTGGCGGAGG + Intergenic
1019393693 7:804856-804878 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1019396089 7:818945-818967 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1019544763 7:1568729-1568751 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1019743769 7:2688409-2688431 CGAGGGCGCCCGGGCGGCGGCGG + Intronic
1019891151 7:3948339-3948361 CGCTGGAACCCGAGAGGTGGAGG - Intronic
1019988326 7:4674649-4674671 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1020182451 7:5933099-5933121 TGCTGGAACCCGAGAGGCGGAGG - Intronic
1020208346 7:6137761-6137783 CGCTGGAATCCGAGAGGCGGAGG - Intronic
1020225747 7:6278584-6278606 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1020248393 7:6448293-6448315 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1020300460 7:6791658-6791680 TGCTGGAACCCGAGAGGCGGAGG + Intronic
1020796568 7:12684835-12684857 CGCTCGAGCCCGGGAGGCGGAGG - Intergenic
1021031790 7:15746100-15746122 CGCTTGAGCCCGGGAGGCGGTGG + Intergenic
1021221943 7:17984857-17984879 CGCTTGGGCCCGAGAGCCGGAGG - Intergenic
1021236432 7:18148538-18148560 CGCATGAGCCCGGGAGGCGGAGG - Intronic
1021446953 7:20744146-20744168 CGCATGAACCCTAGAGGCGGGGG - Intronic
1021991730 7:26147609-26147631 CGCAGGCACTCGACAGGCTGAGG - Intergenic
1022000604 7:26222347-26222369 CGCTGGAACCCGAGAGGCAGAGG - Intergenic
1022159752 7:27697476-27697498 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
1022427781 7:30284946-30284968 AGCGGCCGCCCGAGAGGAGGCGG + Exonic
1022471201 7:30682711-30682733 CGCAGGCCCCCGAGCTGCAGGGG + Intronic
1022542699 7:31153407-31153429 GGCAGGCGGCTGGGAGGCGGAGG - Intergenic
1022722827 7:32956745-32956767 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1022815066 7:33905467-33905489 GGCGGGCGCCCGAGAGCTGGGGG - Exonic
1023815324 7:43945074-43945096 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1024079689 7:45845929-45845951 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1025091349 7:56066702-56066724 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1025125090 7:56338050-56338072 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1026019005 7:66693889-66693911 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1026599956 7:71769768-71769790 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1026635283 7:72076512-72076534 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1026806637 7:73433396-73433418 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1026834202 7:73627330-73627352 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1026926640 7:74198745-74198767 CGCTGGAACCCAAGAGGCGGAGG - Intergenic
1026941357 7:74289661-74289683 CGCCCGGGCCCGAGAGGAGGAGG + Exonic
1026985501 7:74552919-74552941 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1027121799 7:75527591-75527613 CCCCGGCTCCCGAGAGGCCGGGG + Intergenic
1027439702 7:78206373-78206395 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1028893012 7:96009861-96009883 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1029135327 7:98366421-98366443 CCCAGGGGCCCCAGAGGCTGAGG - Intronic
1029541991 7:101189032-101189054 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1029547394 7:101217490-101217512 CCCGGGCGCACGGGAGGCGGGGG + Exonic
1029645931 7:101855792-101855814 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1030241291 7:107328902-107328924 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1031619391 7:123918066-123918088 CGCAGGCGCACGAGGGACGATGG + Intergenic
1031756002 7:125643378-125643400 CGCTTGAGCCCGGGAGGCGGGGG + Intergenic
1032092113 7:128916145-128916167 CGCAGGTGCCTGAGGGGCGCGGG + Intergenic
1032119276 7:129144861-129144883 CGCAGGAGCCCGGCCGGCGGGGG - Intergenic
1032166885 7:129552579-129552601 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1032437158 7:131909607-131909629 CGCAGGAGCCCAAGGCGCGGGGG - Intergenic
1032865857 7:135923527-135923549 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1033044871 7:137952899-137952921 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1033159861 7:138985605-138985627 CCCAGCCACCCGAGAGGCTGAGG + Intergenic
1033385969 7:140875457-140875479 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1034179642 7:149126971-149126993 CGCAGGCGGCCCCGAGGCCGGGG - Intronic
1034290770 7:149929613-149929635 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1034398344 7:150844842-150844864 CGCTTGAGCCCCAGAGGCGGAGG + Intronic
1034485417 7:151358057-151358079 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1034528878 7:151683231-151683253 GGCAGGCGCTGGAGAGGAGGAGG + Intronic
1034653995 7:152714179-152714201 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1035230178 7:157460666-157460688 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1037180503 8:15999627-15999649 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1037805719 8:22057078-22057100 CACAGAGGCCCGAGAGGCGTAGG - Intronic
1037815377 8:22109184-22109206 CGCCGGCGCCCGTGCGGCTGCGG - Exonic
1038034739 8:23677665-23677687 CGCTGGAACCCGAGAGGCGGAGG - Intergenic
1038039724 8:23714548-23714570 CTCAGCGGCCAGAGAGGCGGCGG + Intergenic
1038553672 8:28491348-28491370 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1038789715 8:30657882-30657904 CTCAGCCTCCCGGGAGGCGGCGG + Intronic
1039121381 8:34151623-34151645 TGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1039129531 8:34247600-34247622 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1039169097 8:34721689-34721711 CGCTTGAGCCCGGGAGGCGGGGG - Intergenic
1039868795 8:41528672-41528694 CGCTGGAGCCCGGGAGGCGGAGG + Intergenic
1039943260 8:42109225-42109247 GGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1040065315 8:43140345-43140367 CGGAGGCGCCCGGGAGCCGCGGG - Intergenic
1040361542 8:46669793-46669815 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1040457704 8:47615554-47615576 TGCTGGAACCCGAGAGGCGGAGG - Intronic
1040498587 8:47988307-47988329 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1040501663 8:48010483-48010505 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1040646979 8:49410206-49410228 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1040840303 8:51777817-51777839 CGCATGAACCCGGGAGGCGGAGG + Intronic
1041089642 8:54290114-54290136 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1041247501 8:55902930-55902952 CGCTGGAACCCAAGAGGCGGAGG - Intronic
1041279312 8:56195537-56195559 GGCAGGTGCCAGAGAGGCTGGGG + Intronic
1041937125 8:63346244-63346266 CCCAGGAACCCGGGAGGCGGAGG - Intergenic
1043443154 8:80294650-80294672 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1043453883 8:80394874-80394896 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1043477487 8:80619567-80619589 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1043765381 8:84124645-84124667 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1043874479 8:85468674-85468696 CGCTGGATCCCGGGAGGCGGAGG + Intronic
1044700474 8:94961503-94961525 CGCTGGAGCCCGGGAGGCGGAGG - Intronic
1044974556 8:97650811-97650833 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
1045098769 8:98825455-98825477 CGCCGGCGGCCGCGGGGCGGGGG - Intronic
1045368055 8:101493997-101494019 CGGACGCGCCCGAGAGGAGGGGG - Intronic
1045432163 8:102124196-102124218 CTCTGGCTCCCGAGAAGCGGAGG + Intronic
1045463041 8:102443120-102443142 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1045516500 8:102864484-102864506 CGCAGGCGCCCGAGAGGCGGCGG - Exonic
1046588261 8:116174600-116174622 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1046594093 8:116239799-116239821 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1046662090 8:116958931-116958953 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1046871303 8:119208403-119208425 GGCAGGAGCCCGGGAGGCGGAGG + Exonic
1047110003 8:121779002-121779024 CGCTTGAGCCCGGGAGGCGGGGG + Intergenic
1047495152 8:125403901-125403923 CGCTGGAACCCGAGAGGCAGAGG + Intergenic
1047734878 8:127756538-127756560 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1048059141 8:130899520-130899542 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1048442874 8:134472756-134472778 TGCAGGAGCCCCAGAGGCTGGGG - Intergenic
1048776456 8:137952332-137952354 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1048887446 8:138919721-138919743 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1049511249 8:143027862-143027884 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1049559464 8:143301752-143301774 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1049579233 8:143403717-143403739 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1049710613 8:144061430-144061452 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1049814039 8:144589804-144589826 CCCAGGCGCCTGTGAGGTGGGGG + Intronic
1049958698 9:717199-717221 CACCGGCGCCCTAGAGGTGGAGG + Intronic
1050098674 9:2095167-2095189 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1050436967 9:5621183-5621205 CGCTGGAACCCAAGAGGCGGAGG + Intergenic
1050445850 9:5721970-5721992 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1050543078 9:6686944-6686966 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1050712457 9:8481022-8481044 CACAGCCGCTCGAGAGGCTGAGG + Intronic
1051181522 9:14416974-14416996 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1051618418 9:19028290-19028312 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1051653413 9:19353510-19353532 CCCAGGCACCCGGGAGGCTGAGG + Intronic
1051655882 9:19380778-19380800 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1051893234 9:21964798-21964820 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1053048009 9:34936422-34936444 GGCAGGCGGCTGAGAGGTGGAGG - Intergenic
1053076412 9:35138443-35138465 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1053188087 9:36036278-36036300 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1053259838 9:36652644-36652666 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1053338779 9:37303745-37303767 CGCTTGCGCCTGGGAGGCGGAGG - Intronic
1053376601 9:37612430-37612452 CGCTGGAACCCGAGAAGCGGAGG - Intronic
1055494449 9:76840895-76840917 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1055638407 9:78299594-78299616 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1056657890 9:88524008-88524030 CACTGGAACCCGAGAGGCGGAGG - Intergenic
1056743327 9:89278995-89279017 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1056863808 9:90211924-90211946 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1056916098 9:90747519-90747541 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1057349106 9:94279554-94279576 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1057662767 9:97018108-97018130 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1057746951 9:97759993-97760015 GGCAGGCTCCAGAGAGGCAGAGG - Intergenic
1057869704 9:98708667-98708689 AGCAGGCGCGCGGGCGGCGGTGG + Exonic
1058658621 9:107248434-107248456 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1058928838 9:109698359-109698381 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1059062688 9:111050064-111050086 CGCTGGAGCCCGGGAGGTGGAGG + Intergenic
1059116602 9:111605240-111605262 CGCTTGGGCCTGAGAGGCGGAGG + Intergenic
1059131721 9:111758503-111758525 CGCATGTGCCCAGGAGGCGGAGG + Intronic
1059134486 9:111792484-111792506 CCCAGGTACCCGAGAGGCTGAGG + Intronic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1060136981 9:121166935-121166957 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1060628081 9:125131322-125131344 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1060680392 9:125557938-125557960 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1061038910 9:128128447-128128469 GCCCGGCGCCCGAGAGGGGGCGG + Exonic
1061099757 9:128483800-128483822 CGCTGGAGCCCAAGAGGTGGAGG + Intronic
1061343793 9:130005423-130005445 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1061441335 9:130605898-130605920 CGCACGAACCCGGGAGGCGGAGG + Intronic
1061472121 9:130835199-130835221 CGCAGGCGGCGGCGGGGCGGGGG + Intronic
1061508795 9:131048138-131048160 CGCCTGAACCCGAGAGGCGGAGG - Intronic
1061517852 9:131099808-131099830 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1061923125 9:133793120-133793142 GGCAGGCGCCGGAGTGGGGGTGG - Intronic
1061966912 9:134020069-134020091 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1062507667 9:136886455-136886477 CGCACGCGGCGGAGCGGCGGCGG + Intronic
1185485443 X:478379-478401 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1185491910 X:524379-524401 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1185505469 X:630137-630159 CGCGGGCGCTTGGGAGGCGGCGG - Intronic
1185581970 X:1216615-1216637 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1185597603 X:1317333-1317355 CGCTGGAACCCGGGAGGCGGAGG - Intergenic
1185629272 X:1504230-1504252 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1186087848 X:6010610-6010632 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
1186705693 X:12137940-12137962 CCCAGGAGCCCGTGATGCGGAGG - Intergenic
1186923100 X:14303342-14303364 CGCAGGCACCCGGCAGGCTGAGG + Intergenic
1187497994 X:19812889-19812911 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1187516546 X:19976472-19976494 CGCTGGAACCCGAGAGGCGGAGG - Intergenic
1187527826 X:20070030-20070052 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1187536067 X:20142586-20142608 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1187641457 X:21295428-21295450 CGCTTGAGCCCGGGAGGCGGCGG - Intergenic
1187700313 X:21958758-21958780 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1187870062 X:23757367-23757389 CGCTGGAACCCGGGAGGCGGAGG + Intronic
1188073644 X:25748587-25748609 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1188249472 X:27875160-27875182 TGCCGGAACCCGAGAGGCGGAGG - Intergenic
1188250083 X:27882477-27882499 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1188353495 X:29160972-29160994 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1188619464 X:32202433-32202455 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1188721173 X:33525761-33525783 CGCATGAACCCGGGAGGCGGAGG - Intergenic
1189069569 X:37849171-37849193 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1189391788 X:40582342-40582364 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1189470769 X:41312228-41312250 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1189499939 X:41547012-41547034 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1189749688 X:44207425-44207447 TGCTTGAGCCCGAGAGGCGGAGG + Intronic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1190048142 X:47128964-47128986 CGCTGGAACCCGGGAGGCGGAGG + Intergenic
1190081959 X:47363629-47363651 CGCATGAACCCGGGAGGCGGAGG + Intergenic
1190098939 X:47505295-47505317 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1190112583 X:47603989-47604011 CGCTGGAACCCGGGAGGCGGAGG - Intronic
1190267821 X:48838402-48838424 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1190275901 X:48899059-48899081 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1190805855 X:53836214-53836236 CGCTTGAACCCGAGAGGCGGGGG - Intergenic
1190841372 X:54147776-54147798 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1190847959 X:54211722-54211744 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1192444896 X:71203574-71203596 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1192600338 X:72456713-72456735 CGCGTGAACCCGAGAGGCGGAGG + Intronic
1193864332 X:86711291-86711313 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1196676564 X:118426620-118426642 CGCTGGAGCCCAGGAGGCGGAGG + Intronic
1196791488 X:119468683-119468705 GGCGGGCGCCCGAGGGGTGGCGG + Intronic
1196918261 X:120561160-120561182 TGCAGCCGCCCGGGGGGCGGGGG + Intronic
1197244484 X:124154361-124154383 CGCTTGTACCCGAGAGGCGGAGG - Intronic
1197803757 X:130379358-130379380 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1198135807 X:133749175-133749197 CGCATGGGCCCAGGAGGCGGAGG + Intronic
1198269860 X:135046682-135046704 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1199635075 X:149806319-149806341 CCCAGGCCCCAGAGAGGTGGGGG + Intergenic
1200156422 X:153978665-153978687 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1200249831 X:154547008-154547030 CGCAGGTGCCCGAGAGGCAGGGG - Exonic