ID: 1045519026

View in Genome Browser
Species Human (GRCh38)
Location 8:102887098-102887120
Sequence CTGTGGCAGCAGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 2, 2: 6, 3: 80, 4: 761}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045519026 Original CRISPR CTGTGGCAGCAGCTGGAGGA AGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900112525 1:1014566-1014588 CTGAGGCGGACGCTGGAGGAGGG - Intergenic
900286166 1:1901644-1901666 CTGTGGCCTCAGCTGGTGGGTGG + Intergenic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900401787 1:2475732-2475754 CTGGGGCTGCAGCTGCATGAGGG + Intronic
900530182 1:3149212-3149234 CAGGGGCAGCCACTGGAGGATGG + Intronic
900916519 1:5643525-5643547 CTGTGGTGGCGGCCGGAGGAGGG - Intergenic
900970534 1:5990191-5990213 GTGTGGGAGCAGCCGGAGGTGGG - Intronic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901746957 1:11380183-11380205 CTGTGGCAGATGGTGGAAGACGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
902985793 1:20153285-20153307 CTGCGGCAGCCTCTGGAGGAAGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903586784 1:24421957-24421979 CGGTGGCAGCAGCAGGAGTCAGG - Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905064342 1:35167153-35167175 TAGTGACAGAAGCTGGAGGATGG + Intergenic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
905733523 1:40311776-40311798 CAGAGGCAGGACCTGGAGGAGGG - Intronic
906293526 1:44635293-44635315 CTTTGGCTGCAGCTGGTGCAAGG - Intronic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
907248924 1:53125118-53125140 CTGTGGCAGCACACGGAAGACGG + Intronic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
907311155 1:53539914-53539936 CTGTGGCTGCAGCGTGGGGAGGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
907659524 1:56378998-56379020 CCCTGGCAGCATGTGGAGGATGG - Intergenic
907935571 1:59039107-59039129 CTGAGGCAGCACCAGGAGGCAGG - Intergenic
908051919 1:60242447-60242469 ATGTGGCACGAGCTTGAGGAAGG - Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908959032 1:69671860-69671882 ATGTGGCCGCTGCTGGGGGATGG + Intronic
909473218 1:76053072-76053094 CTCTGGCAGCAGCAGGAGCTGGG + Intergenic
910330235 1:86065080-86065102 ATGAGGCAGCAGCTCTAGGAGGG + Intronic
911051794 1:93677583-93677605 CTGGGGCAGCAGCTGGGTAAAGG + Intronic
911084787 1:93967398-93967420 CCCTGGCAGCAGGTGGGGGAGGG + Intergenic
911151642 1:94602067-94602089 CTGTGGCAGATGCAGCAGGAAGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912277297 1:108273013-108273035 CAGTTGCAGAAGCTGGCGGACGG + Intergenic
912290931 1:108421343-108421365 CAGTTGCAGAAGCTGGCGGACGG - Intronic
912437604 1:109672771-109672793 CTGTGGCTGGAGCTGGATTAAGG + Intronic
912440089 1:109691123-109691145 CTGTGGCTGTAGCTGGATTAAGG + Intronic
912443450 1:109715798-109715820 CTGTGGCTGGAGCTGGATTAGGG + Intronic
912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG + Intronic
912752957 1:112300678-112300700 CTGTGGCTGCAGTTTAAGGAGGG + Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
914330994 1:146670886-146670908 CTGTGGCAGCATCTTGGGGGCGG + Intergenic
914999971 1:152580025-152580047 CTGAGGCAAGAGCTGCAGGAAGG + Intronic
915106277 1:153536778-153536800 CCTTGGCAGCACCTGTAGGAAGG - Intergenic
915513686 1:156400772-156400794 CTGTGGCAGCGGGTGGGGGCTGG + Intergenic
915557045 1:156666626-156666648 CTGTGCCAGACGGTGGAGGAGGG - Intergenic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915893572 1:159793565-159793587 CTAGGGCAGCAGCGGCAGGAGGG - Intergenic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
915955806 1:160219068-160219090 CTGAGGCAGCTGCTGGGGAAGGG + Intronic
916732949 1:167582647-167582669 CTGTGGCAGATGGTGGAAGAGGG - Intergenic
917707091 1:177645718-177645740 CGGTGGCAGCAGCAGAGGGATGG - Intergenic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
918854563 1:189734186-189734208 CTGTGACTGCAGCTGCATGAGGG + Intergenic
919478429 1:198056577-198056599 CAGTGGCAGCAGTTGTAGGCAGG + Intergenic
919678382 1:200409588-200409610 CGGCGGCAGCAGCGGCAGGAGGG - Exonic
920295036 1:204950830-204950852 CTGTGCCAGCCACTGGAGGATGG - Intronic
920455733 1:206099719-206099741 CTTTGACAGCAGGTGGATGATGG - Exonic
920953780 1:210598679-210598701 CCGTGGCTGCTGTTGGAGGATGG + Intronic
921471689 1:215557367-215557389 TGGTGGCAGCAGTTGCAGGAAGG + Intergenic
921540306 1:216406028-216406050 CTGTGGCAGCAGTAGGGGAAGGG + Intronic
921850420 1:219927959-219927981 CAGCGGCAGCAGCTGGCGGAGGG - Exonic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922076918 1:222254067-222254089 CTGTTGCAGCATCTAGGGGAGGG - Intergenic
922106437 1:222517230-222517252 CTGTGGAAGCAGCTAGGTGAGGG + Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922934153 1:229410922-229410944 GGGTGGTAGCAGCTGCAGGAGGG - Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
923549916 1:234955378-234955400 AGTTGGGAGCAGCTGGAGGAGGG + Intergenic
923724644 1:236495561-236495583 TCGAGGCAGCAGGTGGAGGAGGG - Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924775366 1:247111979-247112001 CTCTGGCTGAAGCAGGAGGACGG + Exonic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
924823593 1:247518044-247518066 CTGTGGCAGGAGGTGGAGAAGGG - Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1064086888 10:12351671-12351693 CTGTGGCTCCTGCTGGAGCATGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065282266 10:24151483-24151505 CTATGACAGGCGCTGGAGGAAGG + Intronic
1065629233 10:27660403-27660425 CTGTCGCCCCAGCTGGAGGGCGG - Intergenic
1065734377 10:28738353-28738375 ATCTGGCAGAAGCTGGTGGAAGG - Intergenic
1066037897 10:31512207-31512229 TGGTGGCAGCAGCTGCAGGATGG - Intronic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1066727742 10:38410116-38410138 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1067682107 10:48447934-48447956 ATGGGGCAGCAGGTGGAGGTGGG - Intronic
1067750685 10:48969291-48969313 CTCTGCCTCCAGCTGGAGGAAGG - Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1068613761 10:59089172-59089194 CCTTGGCAGCAGCTGAGGGAAGG + Intergenic
1069012147 10:63386318-63386340 CTGTTGGAGCAGCTGTAGGCAGG - Intronic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1069807678 10:71136235-71136257 CTGGGGCTGCAACTGGAGGGAGG - Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070969553 10:80552287-80552309 TTTTGGCAGCAGCTGGGAGAAGG - Intronic
1071251026 10:83819940-83819962 TTGTAGCAGCAGTTGGATGATGG - Intergenic
1071938041 10:90552217-90552239 CTGTGGCTGGAGCTGGAAGTTGG + Intergenic
1072620016 10:97073591-97073613 CTGGGGCAGAAGCTGAAGGGCGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072801012 10:98392432-98392454 CTGTGGCGTCAGCTTCAGGAAGG + Exonic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073525537 10:104178217-104178239 CTTTGACTGGAGCTGGAGGATGG + Intronic
1073567605 10:104548545-104548567 ATCTGGCAGCATCTGAAGGAAGG - Intergenic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074772774 10:116744129-116744151 CTGTAGCTGGAGCTGGAGTAGGG - Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1076872788 10:133201851-133201873 CTGGGGCGGCAGCAGGCGGACGG + Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076903938 10:133353016-133353038 GTGTGGCAGCAGTTAGGGGATGG + Intergenic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1077048965 11:558237-558259 CTGTGGGAGCTCCTGGAGGAGGG + Exonic
1077251922 11:1564529-1564551 CGGAGGCAGCAGCTGGAAGCTGG + Intronic
1077267606 11:1659761-1659783 CTGCCGCGGCGGCTGGAGGATGG + Intergenic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077440645 11:2567158-2567180 CTATGGCAGCTGCTTGAGCAAGG + Intronic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1077713701 11:4559926-4559948 CTGGGACAGCACCTGGAGGGAGG + Intergenic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1078740280 11:14059736-14059758 CTGTGGCAGCGGCTGCTGGGGGG - Intronic
1078858589 11:15226708-15226730 CCATGCCAGCAGCTGCAGGAAGG + Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1079340487 11:19607463-19607485 CTGAGGTTGCAGCTGGAAGATGG + Intronic
1079794922 11:24789217-24789239 CTTTGGCAGCAGATAGAAGAGGG + Intronic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1080564227 11:33493306-33493328 CTATGGCAGAAGATGGAAGAAGG - Intergenic
1081031398 11:38088718-38088740 CTGTCGCAGAGGCTGGAGGCTGG - Intergenic
1081164185 11:39786964-39786986 CTGTGGCACCAGCTGCAGTGGGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1081963425 11:47154883-47154905 CAGTGGCACCAGCTAGCGGATGG - Intronic
1082708120 11:56518699-56518721 CTGTGTCAGCCCATGGAGGAAGG + Intergenic
1083363942 11:62130118-62130140 CTGTGGCTGAAGCTGGAGTCGGG - Exonic
1083826688 11:65207983-65208005 GTGTGGAGGCAGCTGGAGGGAGG - Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1083966196 11:66045386-66045408 CTGCTGCAGGCGCTGGAGGATGG + Exonic
1084257975 11:67955567-67955589 CTGCGGCTGTTGCTGGAGGAGGG - Intergenic
1084288159 11:68145273-68145295 GGGTGGCTGAAGCTGGAGGAGGG + Intergenic
1084468976 11:69344105-69344127 CTGAGGCAGCAGCTGGATCTTGG + Intronic
1085200075 11:74696640-74696662 CAGAGGCAGCAGCTGGGGGTTGG + Intronic
1085315969 11:75545117-75545139 CTGTGGAGGGAGCTGGAGGCGGG + Intergenic
1085407143 11:76270037-76270059 CTTTGGAAGCAGCTTGGGGAAGG - Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085616618 11:78004909-78004931 CTGTGGCAGCAGCCAGAAGCTGG - Intergenic
1088501850 11:110491084-110491106 CTGTGGCTGCATCTGCAGGGAGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088696490 11:112370525-112370547 GTGCGGCTGGAGCTGGAGGAGGG + Intergenic
1089064420 11:115651628-115651650 ATTTGCCAGGAGCTGGAGGAAGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089816759 11:121182984-121183006 CAGTGGCAGCAGCTGCAGGCAGG + Intronic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090912001 11:131129344-131129366 CAGTGGCGGCAGCTGTAGAAAGG + Intergenic
1091193848 11:133715690-133715712 CTGTGGCAGCCCTCGGAGGATGG + Intergenic
1091203118 11:133797772-133797794 CTGGCGCAGCAGCTGCGGGAGGG + Intergenic
1091242488 11:134063265-134063287 CTTGGGCAGCAGCTGGTGGTAGG + Intergenic
1092508626 12:9128822-9128844 CTCTGGCAGAAGCTGGAGTGGGG + Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094041703 12:26126064-26126086 ATGTGGCAGCAGCGGCAGGTCGG - Intronic
1094123536 12:26998870-26998892 GTGTGGCTGCAGCTGGAGTGTGG - Intronic
1096193382 12:49634061-49634083 TTCCTGCAGCAGCTGGAGGAGGG + Exonic
1096685981 12:53288562-53288584 CTGAGGCAGCTTCTGGAGAATGG + Exonic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1098288472 12:68933087-68933109 CTGTGGCAGCTGCCGGACGGCGG - Intronic
1098461429 12:70736965-70736987 ATGGGGCACCAGCTGGAGAAAGG - Intronic
1098541154 12:71659231-71659253 CTCTGGCAGCAGCAGTATGAAGG - Intronic
1100776393 12:97979470-97979492 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1101111379 12:101489886-101489908 TGGTGACAGAAGCTGGAGGAGGG + Intergenic
1101432867 12:104641388-104641410 CTGTGGCAGCATCTAGGGGAGGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103329496 12:120144344-120144366 CTGGGGCAGCAGCAGGGCGATGG + Exonic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104024495 12:125015877-125015899 CGGTGGCTGCATCTGGGGGAGGG - Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105730850 13:23213926-23213948 GTGTGGCCTCAGCTGCAGGAAGG + Intronic
1105737337 13:23285216-23285238 CTGGGACAGCACCTGGGGGAAGG - Intronic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1105963665 13:25366036-25366058 ATCTGGCAGCAGCTTGAGGATGG + Intergenic
1106021420 13:25919545-25919567 TTAGGGCAGGAGCTGGAGGAGGG - Intronic
1106148967 13:27079501-27079523 CTAGGGGAGGAGCTGGAGGAAGG + Intronic
1106466795 13:30020987-30021009 CTTTGGGAGAAGCTGAAGGACGG + Intergenic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1108601717 13:52000632-52000654 CTGTGGGAGCAGCAGGGGAAGGG - Intronic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1112061287 13:95742069-95742091 CAGTGGCAGCAGCTGTAGGCAGG + Intronic
1112334389 13:98501983-98502005 CTGGGGCAGCAGCTTAAAGAGGG - Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1112769750 13:102782235-102782257 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1113785884 13:113001956-113001978 CTGTGGCTGCTGCTGAAGGCCGG + Intronic
1113830110 13:113289014-113289036 CTCTGTCAGCAGCTGGAGCCAGG + Intergenic
1113917122 13:113881093-113881115 CTGTGGCAGCTGCTGCATGTGGG + Intergenic
1114454456 14:22846092-22846114 CAGTGGCAGCAGGTGGTGGTGGG + Exonic
1114548957 14:23522463-23522485 CTGGGGTGGCGGCTGGAGGAGGG + Exonic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115695861 14:35898078-35898100 CTGTGGCAGTATGTGGAGGTAGG + Intronic
1116207916 14:41891904-41891926 CTGTGACAGAATCGGGAGGACGG - Exonic
1116857413 14:49965221-49965243 GTTTGGCAGGAGCTGGGGGAAGG + Intergenic
1117081290 14:52154797-52154819 AAAAGGCAGCAGCTGGAGGAGGG + Intergenic
1118166857 14:63345194-63345216 CTGCAGCAGCAACTGGAGCAAGG + Intergenic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1119265666 14:73262138-73262160 CTGTGGCACCAGCCGGGGGCAGG + Intronic
1119768158 14:77203807-77203829 CCCTGGCAGCAGCAGGAGGTGGG + Intronic
1120740726 14:88106138-88106160 CAGTGGGAGCAGCTGCAGGCAGG + Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1120851996 14:89180030-89180052 GTGTAGAAGCAGCTGGCGGATGG + Intronic
1121071108 14:91022479-91022501 GAGTGGCAGCAACTAGAGGATGG + Intronic
1121488912 14:94343879-94343901 GTGTGGCACCTCCTGGAGGAAGG - Intergenic
1121784791 14:96649348-96649370 CATTGGCAGCAGCTGCAGGCAGG + Intergenic
1122180920 14:99953985-99954007 CTGTGGCAGGAGCTGAGAGATGG - Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1123017503 14:105382372-105382394 CTGTGGCTGCAGGGGGAGCAGGG + Intronic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1124089703 15:26586874-26586896 TGGTGGCAGAAGCTGGAGGAGGG + Intronic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1125341301 15:38678182-38678204 CTCTAGCAGCTGCTGGAAGAAGG - Intergenic
1125427228 15:39561130-39561152 CTGTGACTGAAGCTAGAGGAAGG + Intergenic
1125680982 15:41530044-41530066 ATGTGGCAGCTGCTGGGTGATGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127081244 15:55382129-55382151 CTGTGGTAGCTGCTGAAGGGTGG + Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1128352920 15:66903398-66903420 GTGTGACAGCAGCTGGAGCTGGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128632466 15:69280481-69280503 CTCAGGCAGAAGCTGCAGGAAGG + Intergenic
1128727098 15:69996278-69996300 CTGTGTCAGCATTTGGGGGAAGG + Intergenic
1128825354 15:70710798-70710820 ATGTGGAGGCACCTGGAGGATGG - Intronic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129447029 15:75625748-75625770 GTGAGGCAGCAGCTGGGGGCGGG - Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG + Intronic
1129686069 15:77686757-77686779 CTCTGGCAGCAGGTGGGAGATGG - Intronic
1129709839 15:77815168-77815190 AGGTGCCAGCCGCTGGAGGAGGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129840233 15:78739275-78739297 ATGTCGCAGCAGCTGTGGGAGGG + Intergenic
1129888949 15:79058365-79058387 CTTCGGCAGCAGATCGAGGATGG - Exonic
1129919788 15:79310823-79310845 GTGCTGCAGCAGCTGGAGGGTGG + Intergenic
1130336103 15:82958567-82958589 CTCTGGCAGCAGATGGGAGAAGG + Intronic
1130539145 15:84809450-84809472 CTGTGGCAGCAGTTGCTGGGAGG + Intergenic
1130539276 15:84810343-84810365 CTGTGGCAGCTCTTGGAGGGAGG + Intergenic
1131032606 15:89198959-89198981 CTGTGGCAGCTGCTGGCCGCTGG + Exonic
1131540078 15:93268424-93268446 CTGTGGCTGGATGTGGAGGATGG + Intergenic
1132146280 15:99431828-99431850 CTGAGGCAGCAGCGGAAGGCAGG + Intergenic
1132646917 16:1003420-1003442 CTGTGGCAGCAGGTGGGGCCCGG - Intergenic
1132680931 16:1141496-1141518 GAGGGGCAGGAGCTGGAGGAAGG + Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132765974 16:1534366-1534388 GTGTGCCAGACGCTGGAGGATGG + Exonic
1133207497 16:4242119-4242141 CCGTGGCAGCAGGCGGTGGAGGG + Intergenic
1133238893 16:4403176-4403198 CTGTGGCTGGAGCTGCTGGATGG - Intronic
1133284186 16:4682990-4683012 CAGCGACAGAAGCTGGAGGAGGG - Intronic
1133712634 16:8415987-8416009 CTGTTGTCGCAGCTGGTGGATGG - Intergenic
1134022978 16:10934189-10934211 ATGTGGCAGGACCTGGAGGGAGG - Intronic
1135587078 16:23679516-23679538 CTCTGGGAGCTGCTAGAGGAGGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136611571 16:31369537-31369559 CAGTGGCAACTGCTGGAGGTTGG - Intronic
1137456204 16:48619876-48619898 CTGTGGAGGCAGCTGCAGGGAGG - Intronic
1137456452 16:48621551-48621573 CTGTGGAGGCAGCTGCAGGGAGG - Intergenic
1137624937 16:49901576-49901598 GGGTGACAGAAGCTGGAGGAGGG - Intergenic
1137767033 16:50985600-50985622 CAGTGGCAGCAGGTGGAGCTGGG + Intergenic
1138441718 16:57039369-57039391 AAGTGGCTGCAGCTGGAGGCAGG + Intronic
1138514150 16:57526715-57526737 CTGTGGGAGAAGCTGGAACAGGG - Intronic
1138897009 16:61218843-61218865 CACTGGCAGAAGCTGGAGGGAGG - Intergenic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139710843 16:68774712-68774734 CCTGGGCAGCAGCTGGAGGGTGG + Intronic
1139800612 16:69519743-69519765 CGGTGGCTGAAGCTGGAGAATGG - Intergenic
1139821765 16:69726670-69726692 CTGAGGCTGCAGCTCCAGGAAGG + Exonic
1140002559 16:71040018-71040040 CTGTGGCAGCATCTTGGGGGCGG - Intronic
1140097434 16:71886827-71886849 GGGTGCCAGGAGCTGGAGGAAGG - Intronic
1140183217 16:72741575-72741597 CAGTGGCATAAGCTGGGGGAGGG - Intergenic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141809524 16:86365696-86365718 CTGTGGCAGCAGCTGCTGTGGGG + Intergenic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1142135233 16:88448973-88448995 CTGTGGCTGCTGCTGTAGGAGGG + Intergenic
1142135363 16:88449511-88449533 CAGGGGCAGAAGCTGGAGGCCGG - Intergenic
1142286906 16:89175202-89175224 CGGTGGAGGCAGCTGGAGGTTGG + Intronic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1142605231 17:1077818-1077840 CTGTGGGAGCAGCAGGCGGCTGG - Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1143096551 17:4481329-4481351 CTGTGGCAGGAAGTAGAGGAAGG + Intronic
1143149957 17:4801581-4801603 TGGTGGCAGCAGCAGGGGGAGGG + Intergenic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143776979 17:9206012-9206034 CTGAGGCAGCATCTGTAGGCTGG + Intronic
1143864851 17:9916475-9916497 CCGAGGAAGCAGCTGGGGGAAGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144334213 17:14254828-14254850 CGGTGACAGGAGCTGGTGGATGG - Intergenic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145312999 17:21710625-21710647 CTGTGGCAGCACCTGGCACAGGG + Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145782465 17:27572010-27572032 CTCTGCCAGCTGCTGGGGGAGGG + Intronic
1146261859 17:31427313-31427335 CTGTGGGAGCAGCTGTAGAGAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146543934 17:33721855-33721877 ATGTGGCAGGAGCTGCAAGAAGG + Intronic
1146696395 17:34911800-34911822 CTGTGGCAGGAATGGGAGGAAGG - Intergenic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1147674394 17:42194534-42194556 CTGAGGGAGGAGCTGAAGGAGGG + Intergenic
1147759635 17:42789074-42789096 CTGTGGCTGTAGGTGAAGGATGG + Intronic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148468822 17:47880886-47880908 TTGTGGCAGAGGCTGGGGGAGGG - Intergenic
1148786547 17:50148796-50148818 CTCTGGCAGCCTCTGGAGGAAGG + Intronic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151369335 17:73638008-73638030 CTGCGGGAGCTGCTGGAGGGCGG + Intronic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1151661931 17:75523802-75523824 AACTGGCAGCAGCTGGGGGAGGG - Intronic
1151767358 17:76139313-76139335 CTGGGACAGCAGCTTTAGGAAGG + Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1151874804 17:76861554-76861576 TCGTGGCAGGAGCAGGAGGAAGG + Intergenic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152466832 17:80471287-80471309 CTGAGGGACCAGCTGCAGGAGGG - Intronic
1152536369 17:80952433-80952455 CTGCAGCAGAAGCTGGCGGAGGG - Intronic
1152546904 17:81004570-81004592 CTGTGGCAGCCGCCCCAGGATGG + Intronic
1152612530 17:81322792-81322814 CGGTGGCAGCAGCTGGTGCAGGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153519499 18:5938445-5938467 CTGAGGCAGGTGCTGCAGGAGGG - Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154027608 18:10723480-10723502 GTGGGGCTGTAGCTGGAGGAGGG + Intronic
1154389502 18:13924285-13924307 TTGTAGCAGCACCTGGGGGAAGG - Intergenic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1154980303 18:21498227-21498249 TTCTGGCAGCAGCTGCTGGATGG + Intronic
1155472292 18:26203896-26203918 GTGTGGCTGCAGCTGAGGGAGGG - Intergenic
1156077349 18:33296509-33296531 CATTGGAAGAAGCTGGAGGAAGG + Intronic
1156489405 18:37487388-37487410 CTGAGGCAGGAGTTGGAGGTGGG - Intronic
1156653183 18:39251984-39252006 CAGTGGCAGCAGCTGTAGAAAGG - Intergenic
1156684518 18:39628372-39628394 CAGTGGCAGAAGGTGAAGGAGGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157384038 18:47247426-47247448 CTGTGGCAGCTGCCGGGGCAGGG - Intronic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158264684 18:55649092-55649114 CAGCGGCAGCAGTTGGAGGGAGG - Intronic
1158548204 18:58413770-58413792 CTGTGGCTGCAGGTGGAGGGAGG - Intergenic
1159079491 18:63721484-63721506 CTTTGGCTGCAGCTGGGGAAAGG - Intronic
1159666145 18:71162465-71162487 CTATGGCAGCATCTAGGGGAGGG - Intergenic
1160276546 18:77442801-77442823 CTGTGGCAGCAACTGGTCCACGG - Intergenic
1160388401 18:78512103-78512125 CGGTGACAGCAGCTGCAGGTGGG - Intergenic
1160526189 18:79539532-79539554 CAGCTGCAGCTGCTGGAGGAGGG - Intergenic
1160672804 19:374183-374205 ATGTGGTGGCAGCTGGGGGAGGG + Intronic
1160909695 19:1468915-1468937 GTCTGGGAGGAGCTGGAGGAGGG - Exonic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1160966192 19:1747976-1747998 CTGTGGCCGCAGCTCTAGGGTGG + Intergenic
1161335441 19:3710450-3710472 CTGAGGCATCAGCTGGGGGCAGG - Intronic
1161366299 19:3881676-3881698 CTGTGGCTGCAGCTGGCAGGGGG + Intronic
1161586386 19:5108021-5108043 CAGTGGCAGCCCCTGGAGCAGGG + Intronic
1162770768 19:12948278-12948300 CTCTGGCGGCAGGTGGGGGATGG - Exonic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163394445 19:17051080-17051102 ATGTGGCAGCAGCGAGAGGTGGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1165370466 19:35402481-35402503 TAGGGGCAGCAGCTGGTGGAGGG + Intergenic
1165390021 19:35533562-35533584 CTGTCGCAGCAACTGGACAACGG - Exonic
1165771390 19:38382428-38382450 ACCTGGCAGCAGCTGGAGGTGGG + Intronic
1165858654 19:38895070-38895092 CTGTGGCAGGAGGGCGAGGAGGG - Intronic
1166047052 19:40235840-40235862 CAGTGGCAGCAGCTGGCGCTGGG + Intronic
1166396158 19:42442791-42442813 TAGTGGCAGCAACAGGAGGAGGG + Exonic
1166736400 19:45087848-45087870 CTGTGGCTGCAGCAGGATGCTGG + Intronic
1166841230 19:45698524-45698546 CTGTGGGAGCAGCAGGGGGGTGG - Intronic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1166911148 19:46158858-46158880 TTGTGGCAGCAGGTGGGGGATGG + Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167933669 19:52889255-52889277 CTTTGGCAGCTGCTGGTGGGTGG + Intronic
1168048389 19:53810397-53810419 CTCCAGCAGCAGCTGGAGGGTGG - Exonic
1168337124 19:55603017-55603039 TTGTGGGAGCAGGTGGAGGGTGG + Exonic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
927199331 2:20568645-20568667 CTGTGGCAGCAGCTCCTGGAAGG + Intronic
927502906 2:23594082-23594104 GTGTGGCAGCCCTTGGAGGAGGG + Intronic
928033554 2:27801125-27801147 ATGTAGCAGAGGCTGGAGGACGG + Intronic
928438204 2:31269678-31269700 CTGAGGCAGCCCCTGGAGGGTGG + Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928920944 2:36526689-36526711 CTCTGGCAGCTTCTGGAGGGGGG + Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929217053 2:39425444-39425466 ATGTGGCAGCATCTGGAGATGGG + Intronic
929266063 2:39920357-39920379 CAGTGGCAGCAGCTGTAGGCAGG + Intergenic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929776299 2:44933055-44933077 TTGAGGTAGGAGCTGGAGGAGGG - Intergenic
929956179 2:46460361-46460383 AGGTGGCAGCAGCAGGGGGAGGG + Intronic
930028021 2:47041303-47041325 CTGTGCCAGACGCTGGGGGAGGG + Intronic
930637571 2:53822902-53822924 AAGAGGCTGCAGCTGGAGGATGG - Intergenic
930712751 2:54564550-54564572 GTGTGGCAGCAGCTGCAGCTGGG - Intronic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932556581 2:72830031-72830053 CTGTGGCAGTATCTAGGGGAGGG - Intergenic
933381082 2:81546582-81546604 CTCTGGAAGCTGCTGGAGAAAGG + Intergenic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
933816702 2:86074380-86074402 CAGTGGCAGCAGTTGTTGGAGGG - Intronic
934887488 2:98037751-98037773 CAGTGGCAGCTGCTGGTTGAGGG + Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
935514654 2:104021443-104021465 CTGTGGCAGTACCTGGAGCCCGG - Intergenic
935612707 2:105042349-105042371 ATGTGGCAGGAGCTGAGGGAGGG - Intronic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
937214916 2:120306389-120306411 AGGTGGCAGCAGGTGGAGGACGG - Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938822735 2:134975661-134975683 CAGTGGCAGCAGCTTCAGGCAGG + Intronic
939008677 2:136819619-136819641 CTGAGCCACCACCTGGAGGAAGG + Intronic
940004887 2:149001429-149001451 GTGTGGCTGCAGCTGAGGGAAGG + Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941234748 2:162957128-162957150 TTGTAGCAGAAGCTGGAGGAGGG - Intergenic
941463288 2:165795159-165795181 TTGTTGCAGCAGCAGAAGGAAGG - Intergenic
941929547 2:170926326-170926348 CTTTAGCAGCAGTTGGTGGAGGG - Intergenic
942350508 2:175047784-175047806 GTCTTGCAGCAGCTGGATGAAGG + Intergenic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
943382551 2:187170216-187170238 CCATGGCAGCATCTGGAGGTGGG + Intergenic
943624239 2:190180854-190180876 AAGTGGCAGCATGTGGAGGACGG - Exonic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
947618585 2:231574284-231574306 AGGTGGCAGCAGCTAGAGCAGGG + Intergenic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
947741438 2:232486743-232486765 CTGGGGCCGCAGCTGCGGGAAGG + Exonic
947851684 2:233293571-233293593 GAGTGGCAGCCGCTGGAGAAAGG + Intronic
948255296 2:236563960-236563982 CTGTGACAGCAGCTGGGGTGAGG + Intergenic
948994673 2:241572394-241572416 CTCTGGCAGCAGCACGAAGAAGG - Exonic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1170555145 20:17508941-17508963 CTGCGGAGTCAGCTGGAGGAGGG - Exonic
1170638617 20:18131754-18131776 ATGAGGCAGCACTTGGAGGATGG - Intergenic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1170950732 20:20933677-20933699 CGGTGGCAGCAGGCAGAGGAGGG + Intergenic
1170974301 20:21147991-21148013 GTGTGGCAGCAGATGAAGGAAGG + Intronic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1171768364 20:29302082-29302104 CTGTGGCGGCGACCGGAGGAGGG + Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172100799 20:32483279-32483301 CGGCGGCAGCAGCCGGAGAAGGG + Intronic
1172132425 20:32664598-32664620 CTGTGGCTGCATCTAGAGGAGGG - Intergenic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1173184627 20:40831106-40831128 GTGGGGCTGCAGCTGGTGGATGG - Intergenic
1173634684 20:44544970-44544992 CTGTGGCCTGAGCTGGAGTACGG + Intronic
1173736265 20:45363625-45363647 CTGTGGCTGGCGCTGGTGGACGG + Exonic
1174230374 20:49041164-49041186 AGGAGGGAGCAGCTGGAGGAGGG + Intergenic
1174358527 20:50014142-50014164 CAGTGGCAGTAGCTGGACGGTGG - Intergenic
1174523959 20:51156564-51156586 CTGTTGGACCAGCTGGGGGAAGG - Intergenic
1175028071 20:55924085-55924107 CTGTGGTAGCTGCTGGAGACCGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175517024 20:59576543-59576565 CTGGGGGAGCCGCTGGGGGATGG + Intergenic
1175598691 20:60255582-60255604 CAGTGGCAGCAGCTGGAATTAGG + Intergenic
1175913019 20:62413632-62413654 TTGAGGCTGCAGCTGGTGGAGGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176367985 21:6045148-6045170 GTGTGGCAGCCACTGGAGGAGGG + Intergenic
1176383179 21:6123931-6123953 CTGTGGCTGCCGCAGGGGGAGGG - Intergenic
1176413084 21:6459272-6459294 CTGGGGCAGGCGCTGGGGGAAGG - Intergenic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178401694 21:32291799-32291821 CTGAGGCAGCAGGTGGATAATGG + Exonic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179191318 21:39124496-39124518 CAGTGACAGAAGCTGGAGAAAGG + Intergenic
1179403065 21:41102321-41102343 CTGTGACAGCTGCTGGAAGGTGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179466648 21:41580272-41580294 CACAGCCAGCAGCTGGAGGAGGG + Intergenic
1179502165 21:41816663-41816685 TTCTGGCAGGAGCTGGTGGATGG - Intronic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1179656967 21:42851709-42851731 CCGTGGCTGCGGCTGCAGGAAGG - Intronic
1179688579 21:43067594-43067616 CTGGGGCAGGCGCTGGGGGAAGG - Intronic
1179740288 21:43414308-43414330 CTGTGGCTGCCGCAGGGGGAGGG + Intergenic
1179755534 21:43493394-43493416 GTGTGGCAGCCACTGGAGGAGGG - Intergenic
1179886304 21:44315666-44315688 CTGAGGCAGCAGCCTGAGGCTGG + Intronic
1180129415 21:45817505-45817527 CTGCGGCAGCAGCTGGAATATGG - Intronic
1180595060 22:16967672-16967694 ATGAGGCAGGAGCTGGAGGAAGG - Intronic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181033163 22:20157858-20157880 CCGAGGCAGCAGTTGGAGGTGGG - Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181508794 22:23379656-23379678 CGGTGGGAGCAGCTGGAGGGAGG - Intergenic
1181510146 22:23385374-23385396 CCGAGGCAGCAGTTGGAGGTGGG + Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182064563 22:27421180-27421202 ATGTGGTTGCAGCTGGAGGGGGG - Intergenic
1182522143 22:30890750-30890772 CTCTGTCAGCCGCTGGAGCATGG - Exonic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1184227305 22:43136469-43136491 AGGAGGCAGCAGCTGGAGGACGG - Intronic
1184270804 22:43381857-43381879 CTGCGAGAGCTGCTGGAGGATGG - Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
1185347901 22:50318549-50318571 CTGGGGCAGGAGCGGGAGGGAGG + Intronic
1185373200 22:50470229-50470251 ACGAGGCAGCAGGTGGAGGAAGG + Intronic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949160022 3:870388-870410 ATTTGGCAGCAACTGGGGGATGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949731511 3:7118351-7118373 CTGTTGCCCAAGCTGGAGGATGG - Intronic
950029091 3:9840188-9840210 CAGTGGCTGCAGCTGGACCAGGG + Exonic
950410814 3:12835513-12835535 CTGAAGCAGCAGCTGGTGGGAGG + Exonic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
951184799 3:19701155-19701177 CTGGGGCATGAGCTGGAGAATGG - Intergenic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
952258873 3:31720246-31720268 CTTTGGCAGTAGTAGGAGGAGGG - Intronic
952338713 3:32427409-32427431 CTGTGGCAGATGCTAGAGAAAGG + Intronic
952530133 3:34254863-34254885 CACTTGCAGCAGCTGGGGGATGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
955332535 3:58059569-58059591 CCACGGCAGCAGCTGGTGGATGG + Intronic
955824298 3:62928958-62928980 GTGTGGTGGCAACTGGAGGAAGG + Intergenic
956466393 3:69524555-69524577 GTCTGGCAGCAGCTGGGGGCTGG + Intronic
956994910 3:74814958-74814980 CTATGGCAGGACCTGGAGGTGGG - Intergenic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
959515886 3:107266687-107266709 CTGGGCCAGCAGCTGAATGATGG + Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960575632 3:119226828-119226850 CAGAGGCAGCAGCTGGATTATGG - Exonic
960701877 3:120447479-120447501 ATGTGGCAGAATCTGGAGGGAGG + Intronic
961469979 3:127105489-127105511 CTGTGGTATCAGCTGGAGATTGG - Intergenic
961485316 3:127211825-127211847 CTGAGGCTTCAGTTGGAGGAGGG + Intergenic
961487634 3:127227741-127227763 CTGTGGCTGCAGCTGGGGCCAGG + Intergenic
962275737 3:134012007-134012029 TTGTGGCAGCAGCTGGAAAGTGG - Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
963779838 3:149476016-149476038 CTCTGGGAGCAGCTGGTGAAGGG + Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
967186685 3:186950113-186950135 CTGTGGAGGGAGCTGGAGGCAGG + Intronic
967827988 3:193894218-193894240 ATGGGGCAGCATCTGGAGGGAGG - Intergenic
968358259 3:198124813-198124835 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
968532604 4:1101688-1101710 CTATGGCAGGAGCTGGAGGAGGG - Intronic
968674449 4:1870429-1870451 CTCCGGCAGCACCTGGAGGCAGG + Intergenic
968915047 4:3493651-3493673 CTGTGGCTGCCACCGGAGGAAGG + Exonic
969409442 4:7018464-7018486 CTGGGGCAGCAGCTGACAGAGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969942354 4:10747002-10747024 ATTTGGCAGCAGGTCGAGGATGG + Intergenic
970756104 4:19428802-19428824 CTGCGGCAGCATCTGGGGGCAGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972541659 4:40044144-40044166 CTGTGGCGGTGGCTGCAGGAGGG + Intergenic
975491884 4:74998196-74998218 CAGTTGCAGCAGTTGGAGGTTGG + Intronic
976620610 4:87123374-87123396 CTGTGGCTGCAGCTGCCAGATGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977781538 4:100986611-100986633 CTGTGGCAGCATCTGGCGGGGGG - Intergenic
978407804 4:108398428-108398450 CTCTGGCAGCAGCCGGAGTCTGG + Intergenic
979254726 4:118598409-118598431 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
979334235 4:119447622-119447644 CTGTGGAAGCAGCTAGGTGAGGG + Intergenic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
980757066 4:137178442-137178464 ATGTTGCAGCAGCTACAGGATGG - Intergenic
980798121 4:137711539-137711561 CTATGGCAGCAGTTGCAGGTAGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981947120 4:150360858-150360880 ATGTGGCAGCATCTGAAAGACGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984067932 4:175072748-175072770 ATGTGGCAGCTGATGGAGGCAGG + Intergenic
984451553 4:179910234-179910256 CTGTGACACCAACTGAAGGATGG - Intergenic
985010165 4:185573913-185573935 CTGGGCCAGAGGCTGGAGGAAGG + Intergenic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985971382 5:3381183-3381205 CTGTGGCTGCCTCTGGAGGCTGG + Intergenic
986082910 5:4412782-4412804 CTGTGGCAGACACTGGAAGATGG + Intergenic
986103080 5:4631902-4631924 CTGTGTCAGGAGCTGGATGCTGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986257752 5:6114759-6114781 CTGTACCAGCACCTGCAGGATGG + Intergenic
986740665 5:10702487-10702509 GTCTGGCAAAAGCTGGAGGAAGG - Intronic
986871290 5:12049818-12049840 CTGTGGCAAAAGCTGGTGGGTGG - Intergenic
987021630 5:13878504-13878526 CTGTGGCTCCAGCTGCTGGAGGG - Intronic
987109114 5:14668203-14668225 CTGTAGCAGCATCTGGGGGTGGG - Intronic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994080737 5:95706397-95706419 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994081620 5:95713470-95713492 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994722304 5:103394142-103394164 TGGTTGCAGCAGCTGTAGGATGG + Intergenic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
997526256 5:134555116-134555138 CTGGGGTGGCAGCTGGGGGAGGG - Intronic
997662264 5:135598564-135598586 CTGTGGCAGAAGCTGAAAGCAGG + Intergenic
997700180 5:135892052-135892074 CTGTGGCTGGAGCTGCAGGAGGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998172462 5:139880726-139880748 ATATGGCAGCAGCAGGAGGGAGG + Intronic
999124711 5:149238752-149238774 CTGGTGCAGCAGCTGGAGATGGG - Intronic
999252365 5:150190383-150190405 CTGGGGGTGCACCTGGAGGAGGG + Intronic
999256214 5:150211208-150211230 CTGTGGCAGTAGGTGGTGGGTGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999730841 5:154475897-154475919 CTTTGGCAGCAGCAGCACGAAGG - Exonic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001845623 5:174918240-174918262 CTGCTGCAGCAGCTGTGGGAGGG - Intergenic
1001949300 5:175805093-175805115 CTGTGGCCGCTGCTGGTGGTGGG + Intronic
1002063036 5:176637714-176637736 CTGTGGCTGCAGCAGAGGGAGGG + Intronic
1002197049 5:177507104-177507126 TGTTGGCAGGAGCTGGAGGAAGG - Intronic
1002322707 5:178385048-178385070 CTGTGGCAGCCCCTGGTGGCTGG + Intronic
1002961364 6:1917844-1917866 GTGAGTCAGAAGCTGGAGGACGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1003693290 6:8376137-8376159 CTGTGGGAGCATATGTAGGATGG - Intergenic
1005456620 6:26026190-26026212 CCGTGGCAGCAGCTATAAGATGG - Intergenic
1006037946 6:31228812-31228834 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006068065 6:31476798-31476820 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006154634 6:32007602-32007624 CTGAGGGAGCGGCTGGAGGCTGG + Intergenic
1006160946 6:32040337-32040359 CTGAGGGAGCGGCTGGAGGCTGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006786160 6:36668775-36668797 CTCTGACTGCAGCTGGAGGTAGG - Intergenic
1006794448 6:36722677-36722699 CTGGTGCAGCAGGTGCAGGAAGG - Exonic
1006834141 6:36986406-36986428 CTGTGGCGGCAGCCGCAGGCCGG + Intergenic
1006940470 6:37748698-37748720 CTATGGCAGGTGCTGGGGGAAGG - Intergenic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007090462 6:39181248-39181270 TTGTGGTAGGAGGTGGAGGAAGG - Intergenic
1007100223 6:39240852-39240874 CTCTGGCACCAGCTGGAGATGGG - Intergenic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1008801263 6:55371010-55371032 GTCTGGCAGCAGTTGCAGGATGG - Intronic
1010712260 6:79188990-79189012 TTGTGGAATCAGCTGCAGGATGG + Intergenic
1011034407 6:82957710-82957732 CTGTGGGACCTGCTGGGGGAAGG + Intronic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012988114 6:105896795-105896817 CTGTGAAAGCAACTGAAGGATGG - Intergenic
1013007999 6:106092371-106092393 CTGTGGGAGCAGGTGAAGCAAGG + Intronic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1014193173 6:118521786-118521808 CTGTGGTAGCAGGTGGGGGCTGG - Intronic
1014586299 6:123202092-123202114 CTGGGCCAGCAGCTGCAGAAGGG + Intergenic
1015764166 6:136698598-136698620 CTGTGACAGCAGCTTCATGAAGG - Exonic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017052797 6:150408992-150409014 GTCTGGGAGCACCTGGAGGAAGG + Intergenic
1017182337 6:151565141-151565163 CTGAAGCAGCAGCTGCAGGTGGG + Intronic
1017209044 6:151834831-151834853 CTGTGGCAGCACCTGGAACTTGG + Intronic
1017336673 6:153269026-153269048 CAGTGGCAGCAGCTGTGGGTGGG - Intergenic
1017786563 6:157761760-157761782 CCGTGGAAGCAGGTGCAGGAAGG + Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018914560 6:168125172-168125194 CTGTGGCTGGAGCTGGCGGGAGG + Intergenic
1019101782 6:169636913-169636935 GTTTGGCAGCAGCTTCAGGAAGG - Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1020262057 7:6536261-6536283 CTGGGGAGGCTGCTGGAGGAAGG - Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1020398239 7:7742508-7742530 CTTTGGCTTCAGCTGTAGGAGGG + Intronic
1020673229 7:11146383-11146405 ATGGGGCAACAGCTGGAGAAGGG - Intronic
1021821367 7:24500791-24500813 CTGTGGCATCACCTCTAGGAAGG + Intergenic
1022471988 7:30687744-30687766 CTGTGCCACCTGCTGGAGGGAGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1024069820 7:45776075-45776097 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1024782287 7:52865230-52865252 CAGTGGCAGCAGGTGTAGGTAGG - Intergenic
1025099569 7:56123577-56123599 CTGTGGGAGAAGCTAGATGAGGG + Intergenic
1025835157 7:65086553-65086575 CTGTGGGAGCAGCTAGGTGAGGG - Intergenic
1025904929 7:65776032-65776054 CTGTGGGAGCAGCTAGGTGAGGG - Intergenic
1026580794 7:71615090-71615112 CTGTGGCAGCTTTTGGTGGAAGG + Intronic
1026806812 7:73434041-73434063 CTGTGGCAGCTGCTGGCGGCGGG + Exonic
1027220370 7:76210168-76210190 CTGTGCCATCAGCTGGAGATTGG - Intronic
1028192697 7:87871026-87871048 CTGTGGCAGCATCTAGGAGAGGG - Intronic
1028595035 7:92539146-92539168 CTCTGGAAGCAGCTGAAGAACGG + Intergenic
1028963617 7:96777033-96777055 CAGTGGCAGTAGCTGGTGGATGG + Intergenic
1029234188 7:99099595-99099617 CTGTGGCAGCGGTGGGAGGTGGG + Intronic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029479709 7:100805138-100805160 CAGTGGCAGGAGCTGGAGTGGGG - Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030338960 7:108355976-108355998 CTGTTGCCCAAGCTGGAGGATGG + Intronic
1030514168 7:110519870-110519892 GTGTGGCTGCAGCTGGAGTTGGG + Intergenic
1031493903 7:122423158-122423180 CTATGGCCAGAGCTGGAGGAAGG - Intronic
1031994614 7:128221529-128221551 CTGTGGGGGCTGCTGCAGGAGGG + Intergenic
1032047210 7:128620361-128620383 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1032458531 7:132092535-132092557 CGGTAGCTGCACCTGGAGGAAGG + Intergenic
1032902071 7:136321072-136321094 CAGTGGTGGCAGCTGGAGGTGGG + Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1034426474 7:151016731-151016753 CTGTGGCCGCAGCTGGACAGGGG + Exonic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035271337 7:157721807-157721829 CTGGGGCTCCCGCTGGAGGATGG + Intronic
1035465438 7:159072188-159072210 CTGCGGCACCTGCTGGATGAAGG + Intronic
1035879050 8:3223854-3223876 CTGTGACAGCTGCTTGTGGAGGG - Exonic
1036259315 8:7227947-7227969 CTGGGGCTGTAGCTGGAGGGGGG - Intergenic
1036282990 8:7417370-7417392 CTCTGGCAGCACCGGGAGCATGG + Intergenic
1036307309 8:7611574-7611596 CTGGGGCTGTAGCTGGAGGGGGG + Intergenic
1036310307 8:7680403-7680425 CTGGGGCTGTAGCTGGAGGGGGG - Intergenic
1036311357 8:7686517-7686539 CTGGGGCTGTAGCTGGAGGGGGG - Intergenic
1036338479 8:7894149-7894171 CTCTGGCAGCACCGGGAGCATGG - Intergenic
1036358152 8:8059558-8059580 CTGGGGCTGTAGCTGGAGGGGGG + Intergenic
1036359229 8:8065700-8065722 CTGCGGCTGTAGCTGGAGGGGGG + Intergenic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1036891729 8:12601252-12601274 CTGCGGCTGTAGCTGGAGGGGGG - Intergenic
1036892798 8:12607385-12607407 CTGGGGCTGTAGCTGGAGGGGGG - Intergenic
1037759602 8:21733211-21733233 GAGTGGCTGCAGCCGGAGGAAGG - Intronic
1037822032 8:22139720-22139742 TGGTGGCGGCAGCTGGAGCATGG - Intronic
1038051244 8:23814828-23814850 CTGTGGCAGCTGCTGAGGAATGG + Intergenic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038369039 8:26969575-26969597 CTGTGGCAGCATCTGGGGCTAGG + Intergenic
1038417146 8:27405341-27405363 CTCTAGCAGCATCTGAAGGAGGG - Intronic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1038727106 8:30091533-30091555 CTTTGGCAGCAAATGGAGCAAGG - Intergenic
1038760179 8:30378654-30378676 CTTTGGGATCAGGTGGAGGATGG - Intergenic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1042323876 8:67507895-67507917 CTGTGCCTGCAGTTTGAGGAAGG + Intronic
1042462098 8:69081326-69081348 ATGTGGCAGCAGCAAGAGGCAGG + Intergenic
1042509159 8:69593155-69593177 CCCTGGCTGCTGCTGGAGGAAGG + Intronic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043050234 8:75377031-75377053 GTGGGACAGGAGCTGGAGGAGGG - Intergenic
1044448139 8:92302166-92302188 CTGTGGCAGCATCTAGGGGTGGG + Intergenic
1044600037 8:93994926-93994948 CTGTGGCAGCAGATTTAGGGAGG - Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044728839 8:95214246-95214268 ATGTGGCAGCAGCTGCCAGAGGG - Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047844830 8:128794506-128794528 CCAAGGCAGCAGCTGGTGGATGG - Intergenic
1048426588 8:134329156-134329178 CCGTGGTAGCTGCTGGAGGAGGG - Intergenic
1049352413 8:142171311-142171333 CAGGGGCTGCAGCTGCAGGAGGG - Intergenic
1049576370 8:143391750-143391772 CTGTGGCCTTGGCTGGAGGAGGG - Intergenic
1049594794 8:143478319-143478341 CTGTGGCTGCCCCTGGGGGAGGG - Intronic
1049612503 8:143562057-143562079 CTGTGCCAGCTGCTGCTGGAGGG + Exonic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1050094273 9:2047388-2047410 CTTCTGCTGCAGCTGGAGGACGG - Exonic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1052695230 9:31869425-31869447 CAGTGGCAGCATCTGTAGGTAGG + Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052888785 9:33676805-33676827 CTGCGGCAGCAGCTGCTGGATGG + Intergenic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053545318 9:39017540-39017562 CTGTGACAGCATCTAGGGGAGGG + Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1053809636 9:41839221-41839243 CTGTGGCAGCATCTAGGGGAGGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054620956 9:67348207-67348229 CTGTGGCAGCATCTAGGGGAGGG - Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054821036 9:69520770-69520792 CTCTGGCATCAGTTTGAGGAGGG - Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1055707380 9:79020468-79020490 CTCTGGCTGCAGCTGGTGGGAGG + Intergenic
1056019469 9:82426355-82426377 CTATGGCAGCAGCTATGGGAAGG + Intergenic
1056331484 9:85524635-85524657 CTGTGGGAACACCTGTAGGAAGG + Intergenic
1056720756 9:89069747-89069769 CTGTGGCAGCTGCCAGAGGCAGG - Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057141550 9:92729544-92729566 GTGTGACAGCAGCTGGGGGCCGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057195358 9:93113375-93113397 CTGTGCCAGCAGCTGGATGTGGG - Intergenic
1057423079 9:94927675-94927697 CTGGGGCAGCAGCCAGGGGAGGG - Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1059328370 9:113518554-113518576 CTGTGGCTGAAGCAGGAGGTTGG + Intronic
1059455844 9:114399662-114399684 CTTTGGATGCAGCTGGATGAGGG - Intergenic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061638128 9:131928505-131928527 ATTTAGCAGCTGCTGGAGGAAGG - Intronic
1061660858 9:132129471-132129493 CTGTGGCTAGAGCTGGAGGGAGG + Intergenic
1061783565 9:133009707-133009729 ATGTGGCAGCAGATGGATGAGGG + Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062044883 9:134420361-134420383 CTGTGGCTGCTGCTGATGGAAGG + Intronic
1062169579 9:135127472-135127494 CTGTGGGAGCCCCTGGAGGGAGG - Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062295564 9:135823706-135823728 GTGTGGCAGCAGGTGGAGTCAGG - Intronic
1062543781 9:137052999-137053021 CTGGGGCAGGAGCTGGAAAAGGG - Intronic
1062580199 9:137226009-137226031 CTGTGGCAGCGGCAGAAGGGGGG - Exonic
1062606126 9:137349637-137349659 CTGTGGGGGCCGCTGGTGGAGGG - Intronic
1062623666 9:137433658-137433680 CTGAGGCAGCTGCTGGAAGAGGG + Intronic
1062742131 9:138181346-138181368 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
1185664448 X:1754096-1754118 CTGTGGCAGGAGCTGCAATATGG - Intergenic
1186222312 X:7363151-7363173 CTTTGCCAGAAGCTGGAGGGAGG + Intergenic
1186386586 X:9116208-9116230 CTTGGGCAGCAGGTGGAGAAAGG - Intronic
1187311792 X:18151574-18151596 CTGTAGCAGCAGCTACAGCAAGG - Intergenic
1187323146 X:18259459-18259481 TTGTGGCAACAGCCAGAGGAAGG + Intronic
1187594960 X:20760710-20760732 ATGGGGCTGCTGCTGGAGGATGG + Intergenic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1187826335 X:23335450-23335472 CTGTTGCAGCAGCTGCGGGGTGG - Intronic
1187856065 X:23637116-23637138 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1188182449 X:27072852-27072874 CTGTAGCAGCATCTAGGGGAGGG - Intergenic
1189123885 X:38425231-38425253 CCCTGTCAGCAGCTGGGGGATGG - Intronic
1189147019 X:38665783-38665805 GTCAGGCAGCAGCTGGGGGAAGG + Intronic
1189228153 X:39430803-39430825 ATCTGGCTGAAGCTGGAGGATGG - Intergenic
1189921432 X:45906636-45906658 CTGAGGCAGGATCTTGAGGAAGG - Intergenic
1190418626 X:50205548-50205570 CAGTGGCTGCGGCAGGAGGATGG + Intronic
1193007932 X:76642219-76642241 CTGTGGCTGCTGCTGGAGGTGGG + Intergenic
1193601061 X:83508777-83508799 CAGAGGCGGCAGCTGGAGGTGGG - Exonic
1193709418 X:84861031-84861053 CCATGGCAGCATCTGGAGCAGGG - Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196279192 X:113802923-113802945 CTCTGGCAGGAGCAGGAGGTCGG - Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1196568146 X:117232156-117232178 CTATGGCAGCATGTGGAGTATGG - Intergenic
1197941595 X:131795786-131795808 GTGCGGCAGCAGCTGGATGGTGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198655049 X:138904672-138904694 CTGTGGTAGAACCTGGAGGCTGG + Intronic
1198694747 X:139324231-139324253 CTGCTGCAGCAGGTGGGGGAGGG - Intergenic
1199193342 X:144997618-144997640 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1200167258 X:154045350-154045372 CTGTGGCAGCAGCTGGAGTCAGG - Intronic
1200171197 X:154076376-154076398 GTGTGGCAGGAGCTGAACGAGGG - Intronic
1200206157 X:154317806-154317828 GGGTGGCAGCACCTGGGGGAAGG + Intronic
1200257919 X:154594767-154594789 GTTCTGCAGCAGCTGGAGGAAGG - Intergenic
1201057581 Y:10011247-10011269 CAGTGGCAGCAACTGCAGGCAGG + Intergenic