ID: 1045523007

View in Genome Browser
Species Human (GRCh38)
Location 8:102919697-102919719
Sequence TCCTCACGCGTTGCTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045523007_1045523013 14 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523013 8:102919734-102919756 AAGTGGAAGTTAACCAGGGAAGG No data
1045523007_1045523018 25 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523018 8:102919745-102919767 AACCAGGGAAGGTGGGGTGAGGG No data
1045523007_1045523017 24 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523017 8:102919744-102919766 TAACCAGGGAAGGTGGGGTGAGG No data
1045523007_1045523016 19 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523016 8:102919739-102919761 GAAGTTAACCAGGGAAGGTGGGG No data
1045523007_1045523019 26 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523019 8:102919746-102919768 ACCAGGGAAGGTGGGGTGAGGGG No data
1045523007_1045523011 9 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523011 8:102919729-102919751 AGGATAAGTGGAAGTTAACCAGG No data
1045523007_1045523021 27 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523021 8:102919747-102919769 CCAGGGAAGGTGGGGTGAGGGGG No data
1045523007_1045523014 17 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523014 8:102919737-102919759 TGGAAGTTAACCAGGGAAGGTGG No data
1045523007_1045523015 18 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523015 8:102919738-102919760 GGAAGTTAACCAGGGAAGGTGGG No data
1045523007_1045523010 -3 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523010 8:102919717-102919739 GGAAAGGCTTAAAGGATAAGTGG No data
1045523007_1045523012 10 Left 1045523007 8:102919697-102919719 CCTGGGGAAGCAACGCGTGAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1045523012 8:102919730-102919752 GGATAAGTGGAAGTTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045523007 Original CRISPR TCCTCACGCGTTGCTTCCCC AGG (reversed) Intronic
904647333 1:31977761-31977783 TCCTCAAGTGTTGCTAGCCCCGG - Intergenic
911526356 1:98991777-98991799 TACTGACTCATTGCTTCCCCAGG - Intronic
912545614 1:110449009-110449031 ACCTCACTCTTTGCTTCTCCTGG + Intergenic
914373392 1:147050801-147050823 TCATCACCCGTCTCTTCCCCGGG - Intergenic
916899015 1:169200722-169200744 TCCTCACCCATTCCTTCCCAAGG + Intronic
919418376 1:197340242-197340264 TCCTCACTCCCTCCTTCCCCAGG - Intronic
923663667 1:235980110-235980132 TCCTCCCGTGTTGCTTCTGCTGG + Intronic
1063385294 10:5612681-5612703 TCCTCCCGCCTTGCCTCCCAAGG - Intergenic
1063489077 10:6446836-6446858 TCCTCTCTCGCTGCTTTCCCGGG - Intronic
1065496112 10:26330027-26330049 TCCTCATGCTCTCCTTCCCCTGG - Intergenic
1070019244 10:72567657-72567679 TCCCCATGGGTGGCTTCCCCTGG - Intronic
1081600231 11:44487808-44487830 TCCACACTCGGGGCTTCCCCAGG + Intergenic
1081774927 11:45670465-45670487 TCATCACCCAGTGCTTCCCCCGG + Intergenic
1088442681 11:109889129-109889151 TCCTCAATAGTTGCTTCCCAAGG - Intergenic
1089419559 11:118321169-118321191 GTCTCTCGTGTTGCTTCCCCTGG - Intergenic
1090805212 11:130198249-130198271 TCATCACTCACTGCTTCCCCAGG - Intronic
1092103526 12:5904688-5904710 TCCTCTAGCCTTGCTCCCCCTGG + Intronic
1098432053 12:70430526-70430548 TCCTCCTGCATTGCTTCCTCTGG + Exonic
1099373463 12:81866421-81866443 TCCTCACTCACTCCTTCCCCAGG + Intergenic
1101741442 12:107503131-107503153 GCCTCACCCGTTCCTTCCCTCGG - Intronic
1105791624 13:23806018-23806040 TCCTCAGGGGATGCTTCCCATGG + Exonic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106358114 13:29003987-29004009 TCCTCACCCTTTCTTTCCCCTGG - Intronic
1118383186 14:65234589-65234611 TCCTCACGCTTGTCCTCCCCAGG - Intergenic
1119287013 14:73463500-73463522 TCCTAAGGCCTTGGTTCCCCAGG + Intronic
1127812899 15:62580009-62580031 TCCTCCATCGCTGCTTCCCCAGG + Intronic
1127994702 15:64146437-64146459 CCCTCACGCCTGGCTTCCCCCGG + Intergenic
1128735895 15:70053722-70053744 ATCTCACACGTAGCTTCCCCAGG - Intronic
1130760162 15:86810966-86810988 TGCTCATGTGTTGCTTCCTCTGG - Intronic
1131785191 15:95904937-95904959 CCCTCACTAGTTGCTTCACCTGG + Intergenic
1131979157 15:97979089-97979111 TGCTCACCCATTGCCTCCCCTGG + Intergenic
1134361276 16:13533262-13533284 TCCTCTCGTTTTGGTTCCCCAGG + Intergenic
1135494827 16:22942289-22942311 TCTCCAGGAGTTGCTTCCCCTGG - Intergenic
1140634009 16:76889171-76889193 TCCTCATGCTCTGCCTCCCCTGG - Intergenic
1143516088 17:7419909-7419931 TCCTCCCTCGTCACTTCCCCAGG - Intergenic
1148132100 17:45268157-45268179 TCCTCAGTCGGTACTTCCCCAGG + Intronic
1157327963 18:46682416-46682438 TGCTCAAGCATTGCTTCCTCAGG - Intronic
1161258129 19:3320996-3321018 TCCTCACTCTTTTCTTCTCCAGG + Intergenic
1162185402 19:8900818-8900840 TCCTCCCACCTTCCTTCCCCAGG - Exonic
1164779188 19:30879008-30879030 TACTCAAGGGTTGCTTCCACAGG + Intergenic
1167754329 19:51402270-51402292 TCCTCTAGCGTTCCTTCACCGGG + Intergenic
1168156618 19:54476820-54476842 TCCTCCCTCTTTGCTTTCCCAGG - Intergenic
1168324227 19:55529991-55530013 TCCTCACGGGCTACTTCCCCTGG - Exonic
934948602 2:98560651-98560673 TCCTCCTCCGTTGCCTCCCCGGG + Intronic
935190208 2:100771581-100771603 TCCTCAGGCTTTGGTTCTCCTGG + Intergenic
937908106 2:127062143-127062165 TGCTCCCGTGTTGCTTCTCCAGG + Exonic
942796941 2:179832211-179832233 TCCTCCCACCTTGGTTCCCCAGG + Intronic
948614346 2:239188777-239188799 TCCTCTCGGGTTGCTCCCTCTGG + Intronic
1173298419 20:41779637-41779659 CCCTCAGGCTTTGCTTCCCCTGG + Intergenic
1180147396 21:45928982-45929004 TCCTCAGGCCTGGCTTTCCCAGG - Intronic
1184011975 22:41755872-41755894 TCCTCACCCTCTGCTTGCCCAGG + Intronic
1184217939 22:43079689-43079711 TTCTCACACAGTGCTTCCCCAGG + Intronic
1185148430 22:49151438-49151460 TCCTCAGGCTTAGATTCCCCTGG - Intergenic
953617301 3:44502833-44502855 TCCTGCCTCATTGCTTCCCCTGG - Intronic
954394813 3:50287880-50287902 TTCTCAGGCCTTGCTCCCCCAGG - Exonic
960550791 3:118973957-118973979 TCCTGACGCTCTCCTTCCCCCGG - Intronic
961066608 3:123882080-123882102 TCATCAGGGGCTGCTTCCCCAGG - Intronic
966902851 3:184499667-184499689 TCCTCACTCGCTTCTTCTCCTGG - Intronic
976660180 4:87532663-87532685 TCCTCACACAGTCCTTCCCCTGG + Intergenic
978581243 4:110233276-110233298 TCCTGATGTTTTGCTTCCCCTGG - Intergenic
982115684 4:152096638-152096660 TCCTCAAGCTTTGCTTCTACGGG + Intergenic
984493616 4:180468329-180468351 TCCTCACTCGCAGCTTCCCTTGG - Intergenic
984744593 4:183202069-183202091 GCCTCACTCATTCCTTCCCCAGG - Intronic
997713729 5:136027460-136027482 TCCTCATGGGATGCTTCACCAGG + Intergenic
1004290181 6:14359666-14359688 TTCTCACACTTTGCTGCCCCTGG + Intergenic
1006391789 6:33762978-33763000 TCCTCACTCTTTGCTGTCCCTGG - Intergenic
1008109596 6:47478003-47478025 TCCTCACCCCTGGCCTCCCCAGG - Exonic
1009052169 6:58289399-58289421 TCCTCACTCATTGCTTCTCCTGG - Intergenic
1013418916 6:109948906-109948928 GCCTCACCTGTTCCTTCCCCAGG - Intergenic
1015256216 6:131182300-131182322 TCCTCACTCCCTCCTTCCCCTGG + Intronic
1019449770 7:1091385-1091407 TCCTCTCCTGTTGCTTCTCCAGG + Exonic
1029705749 7:102274876-102274898 TCCTGCCCCTTTGCTTCCCCAGG + Intronic
1034519601 7:151609649-151609671 TCCTCACGCTCTGCTTCTCGGGG - Intronic
1036681643 8:10878574-10878596 CCCTCACTCCTTGCTTGCCCAGG - Intergenic
1045523007 8:102919697-102919719 TCCTCACGCGTTGCTTCCCCAGG - Intronic
1048151549 8:131900086-131900108 AACTTACGCTTTGCTTCCCCTGG - Intergenic
1053053174 9:34977932-34977954 TCCTCAAGCCATGCTGCCCCTGG + Intronic
1053200210 9:36147173-36147195 CCCTCACACTCTGCTTCCCCAGG + Intronic
1057783115 9:98066073-98066095 TCCTCCATAGTTGCTTCCCCAGG + Intronic
1059741206 9:117151736-117151758 TCCACACACTTTGGTTCCCCTGG + Intronic
1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG + Intergenic
1193278868 X:79624869-79624891 TCCTAATGCCTTGCTGCCCCCGG - Intergenic