ID: 1045526832

View in Genome Browser
Species Human (GRCh38)
Location 8:102947777-102947799
Sequence CAGGCCCACCTCCAACTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045526825_1045526832 -7 Left 1045526825 8:102947761-102947783 CCCAATCACCTCCCAACAGGCCC 0: 2
1: 113
2: 726
3: 2098
4: 4089
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526820_1045526832 6 Left 1045526820 8:102947748-102947770 CCACCCCTCATGACCCAATCACC 0: 1
1: 7
2: 114
3: 390
4: 1406
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526821_1045526832 3 Left 1045526821 8:102947751-102947773 CCCCTCATGACCCAATCACCTCC 0: 1
1: 25
2: 185
3: 394
4: 832
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526819_1045526832 7 Left 1045526819 8:102947747-102947769 CCCACCCCTCATGACCCAATCAC 0: 1
1: 4
2: 9
3: 101
4: 388
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526818_1045526832 20 Left 1045526818 8:102947734-102947756 CCAAAGGGAAAATCCCACCCCTC 0: 1
1: 0
2: 2
3: 24
4: 181
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526822_1045526832 2 Left 1045526822 8:102947752-102947774 CCCTCATGACCCAATCACCTCCC 0: 36
1: 762
2: 4443
3: 8766
4: 13571
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526823_1045526832 1 Left 1045526823 8:102947753-102947775 CCTCATGACCCAATCACCTCCCA 0: 111
1: 3176
2: 7180
3: 12318
4: 14395
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data
1045526826_1045526832 -8 Left 1045526826 8:102947762-102947784 CCAATCACCTCCCAACAGGCCCA 0: 1
1: 69
2: 1421
3: 4366
4: 7089
Right 1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045526832 Original CRISPR CAGGCCCACCTCCAACTTTG GGG Intronic
No off target data available for this crispr