ID: 1045531728

View in Genome Browser
Species Human (GRCh38)
Location 8:102991395-102991417
Sequence CCGGGAACACAGAGCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045531728_1045531735 -2 Left 1045531728 8:102991395-102991417 CCCTGGTAGCTCTGTGTTCCCGG No data
Right 1045531735 8:102991416-102991438 GGGGCTGCCATAGAATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045531728 Original CRISPR CCGGGAACACAGAGCTACCA GGG (reversed) Intergenic
No off target data available for this crispr