ID: 1045536996

View in Genome Browser
Species Human (GRCh38)
Location 8:103039718-103039740
Sequence CTGTGTGTGTGGGAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045536986_1045536996 20 Left 1045536986 8:103039675-103039697 CCTAGATTCTGAATAGATTTGTC 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG No data
1045536985_1045536996 24 Left 1045536985 8:103039671-103039693 CCTACCTAGATTCTGAATAGATT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045536996 Original CRISPR CTGTGTGTGTGGGAAGGGGA AGG Intronic
No off target data available for this crispr