ID: 1045538983

View in Genome Browser
Species Human (GRCh38)
Location 8:103063258-103063280
Sequence GTACTAAGCAGAAGAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045538983 Original CRISPR GTACTAAGCAGAAGAAAAAG TGG Intronic
900817849 1:4863299-4863321 GTTCTAATCAATAGAAAAAGAGG - Intergenic
901139224 1:7017658-7017680 AAAGGAAGCAGAAGAAAAAGAGG - Intronic
902353548 1:15878600-15878622 ATTCTATGCAGAAAAAAAAGTGG - Intronic
904484947 1:30818566-30818588 GTGCTAAGGAGAAGAAAAGCAGG + Intergenic
905837005 1:41133888-41133910 ATTCGAAGCAAAAGAAAAAGAGG + Intronic
907705669 1:56830489-56830511 TTACCAAGCAGAATAAAGAGTGG + Intergenic
908058987 1:60325889-60325911 ATTCCAAGCAGTAGAAAAAGAGG - Intergenic
908569743 1:65396653-65396675 TTACTAAGCACAACAGAAAGGGG - Intronic
908732971 1:67245846-67245868 GTTCCAAACAGTAGAAAAAGAGG - Intronic
908872488 1:68629795-68629817 GTATTAAGGAGCAAAAAAAGAGG + Intergenic
909334420 1:74455037-74455059 ATAGTAAGCAGAAAATAAAGAGG + Intronic
909406661 1:75297685-75297707 GTACTAATTAGAAAAAAAATAGG - Intronic
909427945 1:75549423-75549445 GTACTAAGAAGAAGGAAGAGTGG - Intronic
909783157 1:79574816-79574838 GTTCTGAGTAGAAGAAATAGAGG - Intergenic
909830075 1:80176894-80176916 GTAATAAGAAGAACAAAAAATGG + Intergenic
910085699 1:83399651-83399673 GTTCTAAACAGAAGTTAAAGTGG + Intergenic
910465328 1:87493062-87493084 GTGCTTAGCAGAAGATAAAGAGG + Intergenic
910473220 1:87577799-87577821 GTAAGAAGCAGATGGAAAAGTGG - Intergenic
910584152 1:88860939-88860961 GTATTAAGCAAGAGAAAAACCGG + Intronic
910774289 1:90859834-90859856 ATACTTAGCAGCAGGAAAAGGGG + Intergenic
911964802 1:104352803-104352825 GTAATATCCAGAGGAAAAAGGGG + Intergenic
912866431 1:113261803-113261825 GGCATAAGCAGAAGAAAGAGAGG + Intergenic
912930824 1:113959269-113959291 GGAGCAAGCAGAAGGAAAAGAGG + Intronic
916928964 1:169554387-169554409 ATACTAAGCATCAAAAAAAGAGG - Intronic
916964450 1:169921500-169921522 GTACTTAACAGAAGACAGAGGGG + Exonic
917285989 1:173422078-173422100 GTCCCTAGCAGAAAAAAAAGCGG + Intergenic
918128554 1:181605292-181605314 GACAGAAGCAGAAGAAAAAGGGG + Intronic
918323672 1:183389221-183389243 TTACTCAGCAGAATAATAAGGGG - Intronic
918467243 1:184833196-184833218 GAACTAAGCAGAACTAAAAAAGG + Intronic
918858479 1:189790330-189790352 ATATTAAGTAGAAGAAAAACAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG + Intronic
922584554 1:226723754-226723776 CTACAAAACAGAATAAAAAGAGG + Intronic
923259057 1:232249451-232249473 GTATTAAACAGAAGAAAAACTGG - Intergenic
923634023 1:235676751-235676773 TTACAAAGCAGAAGCAAAAAAGG + Intronic
924066095 1:240223520-240223542 GTTCCAAACAGTAGAAAAAGAGG - Intronic
924386699 1:243505876-243505898 GGACTAAGTGAAAGAAAAAGAGG + Intronic
924530976 1:244893520-244893542 TTACTAACCAGAAGACCAAGGGG - Intergenic
1062773201 10:121445-121467 ATTCTAATCAGTAGAAAAAGAGG - Intergenic
1064705513 10:18069169-18069191 TTCCTATGCAGAAGAAATAGCGG + Intergenic
1066386660 10:34947175-34947197 GTTCCAAGCAGAGGAAACAGTGG - Intergenic
1066505415 10:36037489-36037511 ATACTAAACAGGAGAAAAAAAGG + Intergenic
1069313777 10:67072528-67072550 ATATTAAGCAGAAGAGACAGAGG + Intronic
1069369002 10:67724112-67724134 GGACTGGGCAGAAGAAAAAGTGG - Intergenic
1069481553 10:68787147-68787169 GTCCTAAGGAGTAGAAACAGAGG - Intronic
1071032567 10:81202831-81202853 GTTCTAGGTAGAAGAAAAAAAGG + Intergenic
1071137155 10:82466186-82466208 GTACCAAGTAGAAGAGACAGAGG - Intronic
1072785382 10:98276058-98276080 GAAGAAAGGAGAAGAAAAAGAGG + Intergenic
1073916023 10:108404315-108404337 GACCATAGCAGAAGAAAAAGAGG + Intergenic
1074449492 10:113547681-113547703 GGACTGGGCAGAAGAAGAAGGGG - Intergenic
1075440040 10:122472852-122472874 GTACTAAGGAGTACAAAAACTGG + Intronic
1075472345 10:122701007-122701029 GTATTCAGCAGATGAAGAAGTGG + Intergenic
1076448882 10:130541477-130541499 GAAGAAAGGAGAAGAAAAAGAGG - Intergenic
1076830164 10:132990410-132990432 GCAATGAGCAGAAGAAAAGGAGG - Intergenic
1077261849 11:1626173-1626195 GTGCAAACCAGCAGAAAAAGAGG - Intergenic
1077623617 11:3750432-3750454 GTACTGACCAAAAGAAAAACTGG + Intronic
1077787626 11:5401841-5401863 AGAAAAAGCAGAAGAAAAAGAGG - Intronic
1078144800 11:8715434-8715456 GAATTAATCAGATGAAAAAGAGG + Intronic
1079414775 11:20223561-20223583 GTAATAAGCAGAAAGACAAGGGG - Intergenic
1079481117 11:20881119-20881141 TTACTTATCAGAAGGAAAAGGGG - Intronic
1079719146 11:23788943-23788965 GTAACAAGAAGAAGAAAAAATGG + Intergenic
1080349310 11:31364631-31364653 ACACTAAGCAGGAGAGAAAGAGG - Intronic
1080442731 11:32310349-32310371 GTACAAACCAGGAGAATAAGAGG + Intergenic
1081494266 11:43590851-43590873 GGGCAAAGCATAAGAAAAAGAGG + Intronic
1081684884 11:45035370-45035392 TTACTAAGCAGGAGCAAAACTGG + Intergenic
1081691877 11:45083845-45083867 GTAGGAAGCAGAAGAAAGAAAGG - Intergenic
1082281123 11:50272399-50272421 GCCCTATGCAGAAAAAAAAGTGG - Intergenic
1082694573 11:56345724-56345746 GTGGTAAGCAGAAACAAAAGTGG + Intergenic
1082742605 11:56927224-56927246 ATTCCAGGCAGAAGAAAAAGTGG - Intergenic
1086533284 11:87812236-87812258 GTATTTAGCAAAACAAAAAGAGG - Intergenic
1086801447 11:91182004-91182026 CTACCAAGCAAAAGAAAAACAGG - Intergenic
1087066411 11:94031884-94031906 GTACTGAGGAGAGGAGAAAGTGG + Intronic
1087365960 11:97219307-97219329 CTACTGAGCAGAAGAGAAATTGG - Intergenic
1087629376 11:100632739-100632761 GTGCTAGCTAGAAGAAAAAGTGG - Intergenic
1088001971 11:104893177-104893199 GTAAGAAGCAGAAGGAAAATAGG - Intergenic
1088258611 11:107924516-107924538 GGACTAAGCAGCAGAGAAAGTGG + Intronic
1090000166 11:122949512-122949534 ATACTAACGAGAAGAAAAAGAGG + Intronic
1090986788 11:131774241-131774263 CTACTAAGAAGAAGAAATTGAGG - Intronic
1091065468 11:132506812-132506834 CTACTAGACAGAACAAAAAGAGG + Intronic
1091077514 11:132634044-132634066 GTATTTAGCAGAAGCAAAAAGGG + Intronic
1091088071 11:132742997-132743019 GAAGGAAGCAGAAGGAAAAGTGG - Intronic
1093113983 12:15186960-15186982 TTTCTAATAAGAAGAAAAAGAGG - Intronic
1093612568 12:21180303-21180325 GAACTATGCAAATGAAAAAGAGG - Intronic
1094074413 12:26457142-26457164 GTGCTAAGGAGAAAATAAAGCGG + Intronic
1094314723 12:29126870-29126892 AAAATAAGCAGAAGAAAAAAAGG - Intergenic
1095161597 12:38923913-38923935 TTATTAAGCAGAATAAAAAGCGG - Intergenic
1095236420 12:39801604-39801626 GTACTAGTCATAGGAAAAAGAGG + Intronic
1095413902 12:41954395-41954417 GTACAAAACAGAAGACAAGGGGG + Intergenic
1097615931 12:61884174-61884196 GTATTAAGCGGAGGAATAAGAGG + Intronic
1098261764 12:68678764-68678786 CTACTAAGTAGAAGCAGAAGAGG - Intergenic
1098983625 12:76986033-76986055 GTATAAAGAAGAAGTAAAAGGGG - Intergenic
1099187874 12:79535376-79535398 GAACTCAGGAGATGAAAAAGGGG + Intergenic
1100668246 12:96779259-96779281 TTACAAATCAGAAGGAAAAGAGG - Intronic
1101644646 12:106619965-106619987 GGACAAAACAGAAGAAAAAATGG - Intronic
1102075484 12:110056581-110056603 TTAAAAAGAAGAAGAAAAAGAGG + Intronic
1102512374 12:113424389-113424411 GTCCTAAAGAGAAGAACAAGGGG - Intronic
1103814799 12:123646041-123646063 GTGCTTGGCAGAAGAAACAGTGG + Intronic
1106064579 13:26332873-26332895 GTTCTAAGCACTAGAGAAAGAGG - Intronic
1106286845 13:28325312-28325334 GAAAAAAGCATAAGAAAAAGTGG - Intronic
1108264017 13:48686473-48686495 GGACTTTGCAGAAGCAAAAGTGG + Intronic
1108762415 13:53584853-53584875 GTAATAAACAGAAGAAAAAGAGG - Intergenic
1109420982 13:62112005-62112027 CTACTAAACATAATAAAAAGTGG - Intergenic
1111196876 13:84887035-84887057 GATTTAAGCAGAAGATAAAGGGG + Intergenic
1112870690 13:103967554-103967576 ACTCTAAGCAGAAGAAAAGGTGG + Intergenic
1113196560 13:107814769-107814791 GAACTAAGCAGAAGATGAACAGG + Intronic
1114304912 14:21413770-21413792 GTTGCAAGTAGAAGAAAAAGTGG - Intronic
1114377942 14:22169372-22169394 GTACCTAGGAGAAGAAAGAGAGG - Intergenic
1114894901 14:26975396-26975418 GTTGTAAGAATAAGAAAAAGAGG - Intergenic
1114951359 14:27758295-27758317 GTACAAAGCTGAAAAAAAAAAGG + Intergenic
1115581174 14:34760152-34760174 GTACTAAGGACAAACAAAAGGGG - Intronic
1115949070 14:38699330-38699352 GTACTATGCAGTGGTAAAAGTGG - Intergenic
1116788084 14:49309832-49309854 GTACTCAGCAGACGAAGAAAGGG + Intergenic
1117026430 14:51625109-51625131 ATACTATGCTGAAGACAAAGTGG - Intronic
1117429393 14:55638853-55638875 TTACTAAGGAGAAGAAACACAGG + Intronic
1117466165 14:55996585-55996607 GTTCTAAACAATAGAAAAAGAGG - Intergenic
1117780453 14:59226391-59226413 GTACATAGCAGAAGAATATGGGG + Intronic
1118070434 14:62241175-62241197 CTACTAAGCAGAATAAAGAAGGG + Intergenic
1119591718 14:75894794-75894816 ATACTAATCAGAAGGAAAACTGG + Intronic
1120646934 14:87085459-87085481 GTACTAGGGAGTTGAAAAAGAGG - Intergenic
1120697725 14:87662963-87662985 GTACTAAGAAGAAAATATAGAGG + Intergenic
1121593919 14:95144307-95144329 GTACAAAGGAAAAAAAAAAGAGG - Intronic
1122145280 14:99685007-99685029 GTACTAAGGAGAAGACAAATGGG - Intronic
1122571666 14:102707630-102707652 GTACTAAGCTGAATCTAAAGGGG - Intronic
1124056863 15:26249152-26249174 TTTCTAAACAGATGAAAAAGAGG - Intergenic
1125208157 15:37178528-37178550 GAACTAAGAAGAAGAAAGAAGGG - Intergenic
1125777915 15:42234902-42234924 GTAGTTAGCAGAAGAAATTGAGG - Intronic
1126001393 15:44213432-44213454 GTCTAAAGCAGAAGCAAAAGGGG + Intergenic
1126748057 15:51847017-51847039 CCACTAAGAAGAAGAAAAAGGGG + Intronic
1127764741 15:62174035-62174057 GGATGAAGCAGAAGGAAAAGAGG + Intergenic
1129196387 15:73969725-73969747 GTTCTAAGCAGAGGAACATGAGG - Intergenic
1130441480 15:83958903-83958925 GTAATAAGCAAAATAAAAGGAGG + Intronic
1131275858 15:90980234-90980256 GTACTAACCAGCACAGAAAGGGG + Exonic
1133785112 16:8967395-8967417 GGACTAAGGAGATGAAAAACCGG + Intergenic
1138182614 16:54952296-54952318 GTGCTCAGGAGAAGAAAAAGTGG - Intergenic
1138887236 16:61094302-61094324 GTTCCAAACAGTAGAAAAAGAGG + Intergenic
1140853743 16:78959073-78959095 TTACTAATCTCAAGAAAAAGTGG - Intronic
1143070459 17:4287736-4287758 GTTCTAAGAATAAGAAAAAAAGG + Intronic
1145229508 17:21162784-21162806 GTAGAAAGCAGAAGAAAAATTGG - Intronic
1145758616 17:27411072-27411094 TTACTCACCACAAGAAAAAGGGG + Intergenic
1146419199 17:32666510-32666532 GTATGCAGCAGAAGAAAAAATGG - Intronic
1146889042 17:36493091-36493113 GTATTCAGGAGAAGAAAAATGGG + Intronic
1147355471 17:39892627-39892649 GAACTAAGCAGGGAAAAAAGGGG - Intergenic
1147400354 17:40177308-40177330 GTTCTAAGCAGAAGAAATTAAGG - Intronic
1148467558 17:47873991-47874013 GGAGGAAGGAGAAGAAAAAGAGG - Intergenic
1149193780 17:54095113-54095135 GTTCTAAACATAAGAAAAATGGG - Intergenic
1149351213 17:55789758-55789780 GTTCCAATCAGTAGAAAAAGAGG + Intronic
1149628845 17:58102995-58103017 GAACTAATCAGGAAAAAAAGAGG - Intergenic
1149663164 17:58346789-58346811 GTAAGAATGAGAAGAAAAAGAGG + Intronic
1153994946 18:10432636-10432658 ATAGTAGGCAGAAGAAAAATTGG - Intergenic
1155082044 18:22420021-22420043 GTACTTAGCAGGAGAAATGGGGG - Intergenic
1155594945 18:27474821-27474843 GGCCTAAGCAGAAGAGGAAGAGG + Intergenic
1155681178 18:28488898-28488920 ATTCTAAGCAATAGAAAAAGAGG - Intergenic
1156682145 18:39603692-39603714 GTACAGAGCAGAAACAAAAGTGG + Intergenic
1156724980 18:40116615-40116637 GTACCAATCAATAGAAAAAGAGG - Intergenic
1156928136 18:42607865-42607887 GTACTAAGCTGAACAAACAATGG + Intergenic
1157532555 18:48433641-48433663 CTACAAAGCAGATGAAACAGCGG + Intergenic
1157929824 18:51809358-51809380 TTACTAAGCAGAAGCCAGAGTGG - Intergenic
1159166331 18:64705814-64705836 TTACTTAGCAGAAGATAGAGAGG - Intergenic
1159388521 18:67758612-67758634 GTACTTAGTTGGAGAAAAAGGGG - Intergenic
1159804421 18:72939103-72939125 GAAAAATGCAGAAGAAAAAGGGG + Intergenic
1159989644 18:74889395-74889417 GTATTAAGCCGAGTAAAAAGAGG - Intronic
1160200429 18:76791424-76791446 TTGCTAAGCAGAAGAAAACGTGG - Intergenic
1163827878 19:19533647-19533669 GTGGTAATAAGAAGAAAAAGAGG - Intronic
1163975202 19:20844596-20844618 ATTCTAATCAGTAGAAAAAGAGG + Intronic
1164173931 19:22751176-22751198 GTACTCAGCAGAAGAAACAATGG + Intergenic
1164455934 19:28406630-28406652 GTACCCAGAAGAAGAAAGAGAGG + Intergenic
1165587027 19:36926308-36926330 GACATAAGCTGAAGAAAAAGAGG - Intronic
1168244110 19:55101822-55101844 GTGCTAAGCAGAAGGGACAGCGG + Intronic
926656324 2:15411043-15411065 GTACCAAGCAAAAGAACAGGAGG - Intronic
927021996 2:19026996-19027018 TCACTAAGCAGAAGACACAGAGG + Intergenic
927223444 2:20737286-20737308 GTACTTAGCAGGAGAAATAGTGG + Intronic
928039487 2:27860766-27860788 GAAGGATGCAGAAGAAAAAGAGG - Intronic
928836506 2:35553486-35553508 GTAATAAGAAAAAGAAAAAAAGG - Intergenic
929065105 2:37964490-37964512 GAAATCAGCAGAAGAAAAACTGG - Intronic
929406352 2:41647069-41647091 GTTCTAAGCAATAGAAAAAAAGG - Intergenic
930324386 2:49896816-49896838 GAACTGAGTAGAAAAAAAAGAGG - Intergenic
930889706 2:56369763-56369785 GTACTGAAAAGAAGAAAAAGGGG - Intronic
931899068 2:66767835-66767857 AATCTAAGCTGAAGAAAAAGTGG - Intergenic
932533484 2:72564946-72564968 GCACTAAGCAGAACAAAATCAGG + Intronic
932948780 2:76268912-76268934 AAACTAAGCAGAAGTCAAAGAGG + Intergenic
933100788 2:78254279-78254301 CTAATAGGCAGAAGGAAAAGAGG - Intergenic
933201119 2:79449988-79450010 GTACTCATTAGAAGAAAAATTGG + Intronic
934902202 2:98168997-98169019 ATGCTAAGCACAAGAAAATGAGG + Intronic
934914627 2:98291187-98291209 GTTCTAAGCAGAAACAACAGCGG + Intronic
935050356 2:99520005-99520027 TTACTAAGCAGAAGGTAGAGAGG - Intergenic
937719915 2:125082122-125082144 GGAATAAGCAAGAGAAAAAGGGG - Intergenic
938157489 2:128953744-128953766 GAATTTAACAGAAGAAAAAGTGG + Intergenic
939594552 2:144107709-144107731 ATTCTAAGCAATAGAAAAAGAGG + Intronic
939651997 2:144774992-144775014 GAACAAAGAAGAAAAAAAAGAGG - Intergenic
940262503 2:151796312-151796334 ATAGTAAACAGAAGAAAAAAGGG - Intronic
941092022 2:161187887-161187909 GAAGTCAGCAAAAGAAAAAGTGG + Intronic
941410725 2:165154505-165154527 GGAAGAAGCAGAACAAAAAGAGG - Exonic
941414038 2:165196301-165196323 GTAATAAACAGAAGAAATACTGG - Intronic
941584737 2:167343572-167343594 ATGCTAAGCAGGAAAAAAAGAGG - Intergenic
942280285 2:174356115-174356137 GTATTAAGTAGGAGAAAAGGGGG + Intronic
942392186 2:175507068-175507090 ATTCTAATCAAAAGAAAAAGAGG + Intergenic
942589504 2:177526875-177526897 GCATTAAGCAGAATTAAAAGAGG - Intronic
944069052 2:195649815-195649837 GTAGTAAGATGAAGAAAAACAGG - Intronic
944661823 2:201927865-201927887 AGACTTAGGAGAAGAAAAAGGGG + Intergenic
946620684 2:221559600-221559622 ATAGTAAGCAGAAGGAAGAGAGG - Intronic
948244026 2:236462780-236462802 GCAGTAAGGAGAAGAAAAATGGG + Intronic
1169891829 20:10461749-10461771 GTAATAAGGAAAAGAAAAACAGG - Intronic
1170104862 20:12743213-12743235 GAACTAACAAGAAGAAACAGTGG + Intergenic
1170547177 20:17444464-17444486 CTACTAAGCAAAAGAAAAAAAGG - Intronic
1170778268 20:19400154-19400176 GTACAAAGGAGTAGAAAAACAGG - Intronic
1172453472 20:35046699-35046721 GTACTAGGGAAAAGGAAAAGTGG - Intronic
1172454703 20:35059706-35059728 GAAATAAGAAGAAGAAGAAGAGG + Intronic
1174809904 20:53636796-53636818 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1174809905 20:53636817-53636839 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1175206271 20:57313998-57314020 GTAATCAGGAGAAGCAAAAGAGG - Intergenic
1176930446 21:14803682-14803704 ATTCCAAGCAGTAGAAAAAGAGG + Intergenic
1177612264 21:23466857-23466879 ATTCTAAGCAGCAGAAAATGGGG + Intergenic
1177618533 21:23556664-23556686 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1180112606 21:45670217-45670239 GCAATAAGCACAAGAAAAAATGG - Intronic
1181686766 22:24534555-24534577 CTACTTAGAAAAAGAAAAAGTGG + Intergenic
1181716579 22:24734947-24734969 GTACTAAGCAAAAGAAGCCGAGG + Intronic
1182408282 22:30157645-30157667 TTACAATGAAGAAGAAAAAGAGG - Intronic
950262086 3:11550220-11550242 GTACTAACCAGAAAAAAAAATGG - Intronic
950459291 3:13111700-13111722 GTCCTCATAAGAAGAAAAAGAGG + Intergenic
950543493 3:13625799-13625821 GTTCCAAGCAGAAGAGAAAGTGG - Intronic
950599341 3:14017952-14017974 GTATTAAGTAGAAGTAAAAATGG - Intronic
951459529 3:22934998-22935020 GTACAACCCAGAAGCAAAAGGGG + Intergenic
952687332 3:36164699-36164721 GAAAAAAACAGAAGAAAAAGAGG + Intergenic
953628871 3:44594177-44594199 GTTCCAAGCAGGAGAAAATGAGG + Exonic
954141389 3:48608505-48608527 TTACTAAGCATAGGAAAAGGTGG - Intronic
956830077 3:73038142-73038164 GTAAAAAGCAGGAGCAAAAGTGG + Intronic
957151483 3:76491749-76491771 GTACTGAGGAGAGGGAAAAGAGG - Intronic
957184928 3:76929388-76929410 GTACTGGGCATAAGAGAAAGAGG - Intronic
957275077 3:78080639-78080661 GTACTTAGAAGAGGACAAAGTGG - Intergenic
957587979 3:82157472-82157494 GTAATAAACAGAAAGAAAAGTGG + Intergenic
957720424 3:83989402-83989424 ATACAAAACAGAAGAATAAGGGG - Intergenic
958800025 3:98744461-98744483 GGAGTAAGCAGAAGCAAGAGAGG - Intronic
958869923 3:99545714-99545736 GTAAGAAACAGAAGGAAAAGAGG - Intergenic
959896068 3:111607848-111607870 GTTAAAAGTAGAAGAAAAAGAGG - Intronic
960536495 3:118821056-118821078 ATATTAAGCAGAAAAAAAAGGGG - Intergenic
961271540 3:125693122-125693144 CTACTATCCAGAAGAAGAAGAGG - Intergenic
961380658 3:126494636-126494658 GGACAAAACAGAAGAAAAAGTGG - Intronic
963099543 3:141586418-141586440 GTACTATACAGAACAAAAAAGGG - Intronic
964570860 3:158106162-158106184 GGAGAAAGAAGAAGAAAAAGAGG + Intronic
965005831 3:163021241-163021263 GTGCAGAGAAGAAGAAAAAGTGG - Intergenic
965966325 3:174494685-174494707 GTAATAGCCATAAGAAAAAGAGG + Intronic
967069310 3:185948845-185948867 GAACTGAACAGAAGAGAAAGAGG + Intergenic
967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG + Intergenic
970349522 4:15187947-15187969 GGACTGAGAAGAAGAAAGAGGGG + Intergenic
970771497 4:19618460-19618482 GGACTAAGCAAATCAAAAAGAGG + Intergenic
971055101 4:22903541-22903563 GGACTAAGCACAAGAAAATAAGG - Intergenic
971065126 4:23022869-23022891 GTACTAAATAGAAGAAAATTTGG - Intergenic
972186408 4:36533540-36533562 GTATGAAGCAGAAGAAAACTAGG - Intergenic
973752579 4:54037058-54037080 ATAGTAAGTAAAAGAAAAAGGGG + Intronic
974123639 4:57668816-57668838 CTATGAAGCAGAAGAAAAGGAGG + Intergenic
974911789 4:68132002-68132024 GTGCTAATCACAAAAAAAAGGGG - Intergenic
975421775 4:74173035-74173057 GTAAGAAGCAGAAGAGAAAGAGG - Intronic
975611515 4:76208594-76208616 GGAGAAAGCAGAGGAAAAAGTGG + Intronic
975632144 4:76414829-76414851 ATACTGAGAAGAAGAAAAAGAGG - Intronic
976345129 4:83991783-83991805 GTACCAAGCAAAAGTAAAAAAGG - Intergenic
976516004 4:85967241-85967263 TTACGAAGTAGAAGAAAATGAGG + Intronic
976541544 4:86282988-86283010 CTGCTAAGGAGATGAAAAAGAGG - Intronic
977110860 4:92953063-92953085 GTACTAAGAAGAGGGAAATGTGG - Intronic
977325056 4:95564494-95564516 GTACAAAACAGAATACAAAGAGG + Intergenic
977425879 4:96866462-96866484 ATTCCAAGCAGTAGAAAAAGAGG + Intergenic
977593394 4:98851355-98851377 GCTCTAAGCAGAGGAAAAAATGG + Intergenic
977964783 4:103132421-103132443 GTGAGAAGGAGAAGAAAAAGAGG + Intronic
978651440 4:111010232-111010254 GTGTTAAGGAGAAGAAAAAAAGG + Intergenic
978860892 4:113447721-113447743 GTGCCAAGCAGAAGAAAATCAGG + Intergenic
979505700 4:121494254-121494276 CTAATAAGCATATGAAAAAGTGG + Intergenic
979535497 4:121815529-121815551 CTAATAAGCAGGAGAAAAATGGG + Intronic
979745486 4:124207252-124207274 TTATTAAGCAGAAGAAACACTGG - Intergenic
980402278 4:132306838-132306860 TGACAAAGCAGAATAAAAAGTGG - Intergenic
980452682 4:132995826-132995848 GTACCAAGGATAAGAAAAAAAGG + Intergenic
981415957 4:144493809-144493831 CTCCTCAGCAGGAGAAAAAGGGG - Intergenic
982871792 4:160588557-160588579 GTAGGAAGTAGAAGAACAAGAGG + Intergenic
982983727 4:162176870-162176892 GTAATAAAAAGAAGAAAGAGGGG - Intergenic
983772688 4:171570853-171570875 GTAAAAAGGAAAAGAAAAAGGGG + Intergenic
983867568 4:172787292-172787314 CTAATAACCACAAGAAAAAGAGG - Intronic
984100846 4:175483945-175483967 ATACTAAGTAGAACAAAAAGTGG + Intergenic
987226302 5:15845088-15845110 GTGCAAGGCAGAAGAGAAAGTGG - Intronic
989494522 5:42096648-42096670 GTACTATGTTGAAAAAAAAGTGG + Intergenic
989823221 5:45820754-45820776 GAACTGAGCAGATGAAAAAGAGG + Intergenic
989982613 5:50662492-50662514 TTTCTAAGAAAAAGAAAAAGAGG + Intergenic
990012536 5:51017952-51017974 GTAGGAAGCAAAAGAAAATGAGG - Intergenic
990165166 5:52986722-52986744 GAGCTAAGGAAAAGAAAAAGAGG + Intergenic
990215320 5:53525275-53525297 GAACTAAGCAGAAGAGAAAGAGG - Intergenic
990276399 5:54201599-54201621 TTACTAAGAAGAAGCATAAGGGG - Intronic
990276966 5:54207634-54207656 CTAGAAAGCAGAAGAACAAGTGG + Intronic
991025387 5:62023802-62023824 ATTCCAAGCAGTAGAAAAAGAGG - Intergenic
991624842 5:68589924-68589946 GTGCTCATCATAAGAAAAAGAGG + Intergenic
992953097 5:81879922-81879944 GTAATAACCAGAATAAAATGGGG + Intergenic
993313998 5:86375929-86375951 GTACCATGCAGAAAAAGAAGTGG - Intergenic
993575747 5:89598225-89598247 GTACAAAGTATAAGAAAATGAGG - Intergenic
993854809 5:93060944-93060966 GTACTAATCACCATAAAAAGAGG - Intergenic
994763602 5:103887851-103887873 GTCCTAACCATAAGAAAAAGAGG + Intergenic
996053310 5:118956709-118956731 GTACTAAACAAAAGCAAATGTGG + Intronic
996854624 5:127991311-127991333 ATTCCAAGCAGTAGAAAAAGAGG - Intergenic
997255634 5:132425975-132425997 GAACTAAACAGAAGAGAAACAGG - Intronic
997260412 5:132461407-132461429 GTACAAAGAAGGAAAAAAAGGGG + Exonic
998102757 5:139448019-139448041 GTATAAAGAAGAAGAAGAAGGGG + Intergenic
999337306 5:150733122-150733144 GAAATAATCAGAAGATAAAGGGG + Intronic
999850926 5:155537887-155537909 AAACAAAACAGAAGAAAAAGTGG + Intergenic
999921525 5:156326741-156326763 GTGTTGAGCAGAAGAAAGAGAGG + Exonic
999955433 5:156696357-156696379 GTTCTTAGGAGAAGAATAAGAGG - Intronic
1000455498 5:161443621-161443643 ATTCTAAGCAGGAGAAAAACAGG - Intronic
1000691880 5:164333327-164333349 GGATGAAGTAGAAGAAAAAGTGG + Intergenic
1001076642 5:168633553-168633575 CTTCTAATCAGTAGAAAAAGAGG + Intergenic
1002683038 5:180983388-180983410 GTGCCAAGCAGAAGCACAAGAGG + Intergenic
1002851994 6:1004430-1004452 GAATTAATCAGAAGAAAAATTGG + Intergenic
1003958140 6:11185146-11185168 GTTCTGAGAAGAAAAAAAAGAGG - Exonic
1004303972 6:14483577-14483599 ATTCTAATCAGTAGAAAAAGAGG + Intergenic
1004829261 6:19459883-19459905 TTATTAAGCAGAAGAAACAGTGG - Intergenic
1006471898 6:34234428-34234450 GTATTAAGCAGAAGAGCGAGTGG - Intergenic
1007054516 6:38869066-38869088 GTACAAAGTTGAAGAAGAAGTGG + Intronic
1008205813 6:48654776-48654798 GTACTTAGCAGAAAAAAATGAGG + Intergenic
1008301960 6:49851861-49851883 TTACATAGCAGAAGAAACAGAGG - Intronic
1008328494 6:50216666-50216688 GAAATAAAGAGAAGAAAAAGAGG + Intergenic
1009849170 6:69173396-69173418 TTTTTAAACAGAAGAAAAAGTGG + Intronic
1009916558 6:70004199-70004221 GTACAAGCCAGAAGAAAATGGGG - Intronic
1010906249 6:81493633-81493655 GAATAAAGTAGAAGAAAAAGCGG - Intronic
1011192857 6:84751099-84751121 TTTCTAAGCAGAAGAAAAATTGG + Intronic
1012029533 6:94040431-94040453 GTTCTAATCTGAAAAAAAAGAGG - Intergenic
1012535940 6:100297073-100297095 GTACTGAGCTGAAGAAACACAGG + Intergenic
1012628710 6:101435724-101435746 GCATTAATCAGAAGAGAAAGTGG - Intronic
1012909802 6:105105634-105105656 GTAGTAAGAACAAGAAAAAGAGG + Intronic
1012958126 6:105592627-105592649 GTACTAGGCATGAGAAACAGAGG - Intergenic
1013765188 6:113566126-113566148 CATCTAAGCAGGAGAAAAAGTGG - Intergenic
1013986701 6:116202272-116202294 ATGCTAAGCATAAGAAAAAAAGG - Intronic
1015123681 6:129728703-129728725 GTACTAAGCAGCAAAACAAATGG + Intergenic
1015351298 6:132223447-132223469 ATACTATGCAGAACAAAAAATGG + Intergenic
1015695071 6:135970885-135970907 GTAGTAAACAGAAGAAAAGAGGG + Intronic
1015871783 6:137782785-137782807 TTAAGAAGCAGCAGAAAAAGGGG - Intergenic
1016597803 6:145821094-145821116 GTAGTAGGCAGAAGCAAAAGGGG + Intergenic
1016755464 6:147680501-147680523 GTAATAAGCAAAAGAAATAAAGG - Intronic
1016903110 6:149121403-149121425 GTACTTAGCAGAAGGAATAGGGG - Intergenic
1017757984 6:157545731-157545753 GGAAGAAGCAGAAGGAAAAGAGG + Intronic
1017780144 6:157709539-157709561 GTCCTTAGAAGAAGAGAAAGAGG - Intronic
1018662761 6:166103416-166103438 GTACCAAGAGGAAGAAAAGGAGG + Intergenic
1018994292 6:168699441-168699463 GCACTAAGCAGAGGAACCAGAGG + Intergenic
1019931914 7:4229332-4229354 GAAGTAAGCAGAATAAAAATGGG + Intronic
1020852549 7:13375807-13375829 GTACCAAGCAGAAGTCATAGAGG - Intergenic
1021643252 7:22761419-22761441 GTTCTTAGCAGGAGAAATAGGGG + Intergenic
1021679694 7:23117574-23117596 AGACTAAGCAGAAGGAAAAGAGG - Intronic
1021750869 7:23798205-23798227 GTTCCAAACAGTAGAAAAAGAGG + Intronic
1022371645 7:29777144-29777166 GTGGTAAACAGCAGAAAAAGTGG + Intergenic
1022634227 7:32116780-32116802 GTTCTAAGCAATAGCAAAAGGGG - Intronic
1023693449 7:42818742-42818764 GGAAGAAGGAGAAGAAAAAGAGG + Intergenic
1023775569 7:43602942-43602964 ATACTAAACAAAAGAAAAACAGG - Intronic
1024781151 7:52849983-52850005 ATACAAAGGAGAAGAAATAGTGG + Intergenic
1027302575 7:76856112-76856134 GTTCTAAACAGAAGTTAAAGTGG + Intergenic
1027690613 7:81340305-81340327 ATAACAAGCAGAAGAAAAATTGG - Intergenic
1029537546 7:101165131-101165153 GTACTAAGCAGCAGCAATATGGG + Intronic
1030371189 7:108701028-108701050 GTACTGGGCAGCAGAAATAGAGG + Intergenic
1030521552 7:110604055-110604077 GTATAAAGCTGAAGAAAAAAAGG - Intergenic
1030542170 7:110844639-110844661 GTCCTACGCAGAAGACAGAGTGG + Intronic
1030625533 7:111842119-111842141 GTACTTAGCAGGAGGAATAGGGG - Intronic
1032288660 7:130566251-130566273 GTACCAAGCATATGAAAAAATGG - Intronic
1032481422 7:132250131-132250153 GTACTTAGATGAGGAAAAAGAGG - Intronic
1033004582 7:137547886-137547908 GGAGTTAGCAGAAGATAAAGAGG + Intronic
1033065810 7:138152965-138152987 GAACTAATCAGAAAAAATAGAGG - Intergenic
1033352503 7:140573059-140573081 ATACTAGGCTGAAGAAAGAGCGG - Intronic
1033754690 7:144388613-144388635 GCACTGGGCAGAAGAAAAAGTGG - Intergenic
1034582060 7:152052635-152052657 TTACAAAGCAGAAGAATAAGAGG - Intronic
1035590240 8:807238-807260 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590241 8:807270-807292 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590242 8:807302-807324 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590243 8:807334-807356 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590244 8:807366-807388 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590245 8:807398-807420 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590246 8:807430-807452 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590247 8:807462-807484 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590248 8:807494-807516 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035590249 8:807526-807548 GTATGAATGAGAAGAAAAAGAGG - Intergenic
1035757625 8:2045951-2045973 TTACTAAGTAGAAGTAAAACAGG + Intronic
1035955071 8:4068216-4068238 GTTAAAAGCAGAAGAAAATGAGG + Intronic
1037873261 8:22520411-22520433 GAGTTAAGGAGAAGAAAAAGGGG - Intronic
1039068393 8:33629192-33629214 GTACTAAGCAGAAAAAAAAATGG - Intergenic
1039935464 8:42040428-42040450 GTTGTAAGCATAAGAAAAATTGG + Intronic
1041768772 8:61449884-61449906 GTACTTAGCCAAAGAAATAGGGG + Intronic
1041773876 8:61502823-61502845 TTACTAAGAAGAATTAAAAGAGG + Exonic
1041862029 8:62525402-62525424 GTACAAAACAGAAGAGAAAGAGG - Intronic
1041866692 8:62582216-62582238 TTAATAAGTAGAAGAAAAAAGGG - Intronic
1042056277 8:64767460-64767482 GTACTCAGCAGAAGAAAGAACGG + Intronic
1042971385 8:74413200-74413222 GCATTAAGTAGAAGAAACAGGGG - Intronic
1043386592 8:79754973-79754995 CTTCTAGGCAGAAGAGAAAGTGG - Intergenic
1043484804 8:80688328-80688350 GTAATAAGCAGAATGGAAAGGGG - Intronic
1043815672 8:84798203-84798225 GTACTCAGCAGATGGAAATGTGG - Intronic
1043840529 8:85098362-85098384 TCATTAAGCAGAAGTAAAAGGGG + Intergenic
1045538983 8:103063258-103063280 GTACTAAGCAGAAGAAAAAGTGG + Intronic
1046456043 8:114463217-114463239 TTACTAAACACAAGAAAAACAGG - Intergenic
1047474599 8:125214533-125214555 ATTCTAAGCAGAGGCAAAAGGGG - Intronic
1048439174 8:134447417-134447439 TTTCTAAGGATAAGAAAAAGAGG + Intergenic
1049566509 8:143341871-143341893 CTAATAAGAAGAAGAAGAAGGGG - Intronic
1050490872 9:6186595-6186617 GGAATAAGAAAAAGAAAAAGAGG + Intergenic
1051168176 9:14287943-14287965 GAACTCAGCAGAAGAAAAAATGG - Intronic
1051785068 9:20733267-20733289 GTCCTAAGCAGAAGACACCGTGG + Intronic
1052114343 9:24631193-24631215 TTACTAAACAGAGGAGAAAGGGG + Intergenic
1052535546 9:29741448-29741470 ATGCTAAGGTGAAGAAAAAGAGG + Intergenic
1052629519 9:31019348-31019370 GTTCTGAGCAGGAGAGAAAGTGG + Intergenic
1053092053 9:35287536-35287558 TTAAAAAGAAGAAGAAAAAGAGG - Intronic
1053195139 9:36111693-36111715 ATACCAAGCATAAGAAAGAGTGG - Intronic
1053524480 9:38814960-38814982 GAAAGAAGAAGAAGAAAAAGAGG - Intergenic
1055491728 9:76811995-76812017 GTACTAAGAAAAGGAAAGAGGGG + Intronic
1055697269 9:78899596-78899618 GTAATAATGAGAAGAAAAAGTGG + Intergenic
1055721873 9:79183603-79183625 GTAGTAAACAGAAAGAAAAGGGG + Intergenic
1056023561 9:82467021-82467043 GCACTAAGCAGAGGACACAGAGG - Intergenic
1056324863 9:85468421-85468443 GCACTAAGAAAAAGAAAATGAGG + Intergenic
1056433659 9:86554124-86554146 GGAATAAGAAGAAGAAGAAGAGG - Intergenic
1056748172 9:89323310-89323332 GTCCTAAGCAGAAAGATAAGAGG + Intronic
1058634871 9:107028734-107028756 GTCTTAAGCAGAAAAAAAAGGGG - Intergenic
1059283739 9:113155572-113155594 GCACTCAGCAAGAGAAAAAGGGG + Intronic
1059559413 9:115318197-115318219 GTACAAAGAAGTAGAAAATGGGG + Intronic
1059720898 9:116959283-116959305 GTTCTAGGCAGAAGGACAAGAGG + Intronic
1060185210 9:121559965-121559987 ATCCCAAGCAGAAGAAATAGAGG + Intergenic
1060440642 9:123636053-123636075 GTACTAAGCCGAAGCAAATCAGG + Intronic
1186762482 X:12737554-12737576 GTACAGAGCAGAAGATACAGTGG + Intergenic
1188215556 X:27472276-27472298 GTACTATTAAGAAGAAAAAGAGG - Intergenic
1188635268 X:32422048-32422070 AAACCAAGCAGAGGAAAAAGTGG - Intronic
1188927723 X:36066452-36066474 TTACTATTCAGAAGAAATAGAGG + Intronic
1188985475 X:36764932-36764954 GTACTCAGCAGAAACAAAGGTGG - Intergenic
1190777994 X:53569552-53569574 GGACTAAGAAGAAGAATAAGGGG + Intronic
1192282254 X:69699324-69699346 TTACTCCTCAGAAGAAAAAGAGG - Intronic
1193106549 X:77681220-77681242 GTAATGAGCAGAAGGAAAAGCGG - Intronic
1193575475 X:83190489-83190511 CAACAAAGCAGAAGACAAAGGGG - Intergenic
1193972658 X:88075314-88075336 GAACCAAACAGAAGAAAAATAGG + Intergenic
1196101015 X:111847232-111847254 GTACCAGGCAGTAGATAAAGAGG + Exonic
1196428619 X:115598377-115598399 GGTTGAAGCAGAAGAAAAAGTGG - Intronic
1197333339 X:125180847-125180869 GTTCTAAGCAAAAGAATAAGTGG - Intergenic
1197831918 X:130652037-130652059 GTACTAAGCAAAAGGAAATATGG - Intronic
1198582758 X:138084637-138084659 GTTCTAAGCACAGAAAAAAGTGG - Intergenic
1198715091 X:139549901-139549923 GAACCAGGCAGAAGAACAAGTGG - Intronic
1199159780 X:144595705-144595727 GTATCAAGCAGAAGAATTAGTGG - Intergenic
1199577713 X:149329600-149329622 GTACAAGGCAGTAGAGAAAGTGG - Intergenic
1201235937 Y:11911655-11911677 ATATTAAACAGAAGAAAGAGTGG + Intergenic