ID: 1045539069

View in Genome Browser
Species Human (GRCh38)
Location 8:103064859-103064881
Sequence TAATAAAGAGGTCCAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045539069_1045539073 9 Left 1045539069 8:103064859-103064881 CCTTACATTGGACCTCTTTATTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1045539073 8:103064891-103064913 CCAGCAATAGGAAATTGATTTGG 0: 1
1: 0
2: 1
3: 19
4: 184
1045539069_1045539074 21 Left 1045539069 8:103064859-103064881 CCTTACATTGGACCTCTTTATTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1045539074 8:103064903-103064925 AATTGATTTGGAGAAATCAAAGG 0: 1
1: 0
2: 3
3: 34
4: 406
1045539069_1045539071 -3 Left 1045539069 8:103064859-103064881 CCTTACATTGGACCTCTTTATTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1045539071 8:103064879-103064901 TTATAACACAGTCCAGCAATAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1045539069_1045539075 22 Left 1045539069 8:103064859-103064881 CCTTACATTGGACCTCTTTATTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1045539075 8:103064904-103064926 ATTGATTTGGAGAAATCAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045539069 Original CRISPR TAATAAAGAGGTCCAATGTA AGG (reversed) Intronic
902301410 1:15505244-15505266 GAATGAAGAGGTCCAGGGTAGGG + Intronic
903726462 1:25450089-25450111 TAATGCAGAGGTTCAATGTTTGG - Intronic
908924036 1:69231461-69231483 TAATAAATAGGCCCAGTGTCTGG + Intergenic
911635275 1:100228346-100228368 TAACAACTAGGTGCAATGTATGG + Intronic
911683301 1:100744357-100744379 TAATAAAGAAGTTAAATGTGTGG + Intergenic
912024190 1:105146144-105146166 AAATAAAGAGCTCAAATGTTAGG - Intergenic
913361004 1:117979924-117979946 TAATAAAACAGTACAATGTATGG - Intronic
913385194 1:118251617-118251639 TAATAAAGAGGACAAATATCAGG + Intergenic
916690089 1:167181761-167181783 TAATTAAGAGATGCAAGGTAGGG - Intergenic
917236398 1:172897185-172897207 TGATATCAAGGTCCAATGTATGG - Intergenic
919467624 1:197941546-197941568 TAATATTCAGGTCAAATGTATGG - Intergenic
924768752 1:247059805-247059827 TAGCAAAGTGGTACAATGTAAGG + Intronic
1063920302 10:10926018-10926040 TAATAAAGAAGGACATTGTAAGG - Intergenic
1064934175 10:20661877-20661899 TAATATAGGTGTCCAATGTTTGG + Intergenic
1068182486 10:53539354-53539376 TAATATAGAGGGCCAATAAAAGG - Intergenic
1068453489 10:57224348-57224370 TAAGACATAGGTCAAATGTATGG - Intergenic
1071265361 10:83960055-83960077 GATTCAAGAGGTCCAGTGTAGGG - Intergenic
1079559219 11:21802035-21802057 TGATAAAGAGCTCCAATCTAAGG + Intergenic
1079663481 11:23072825-23072847 AAATAAAGCGGGCCAATATATGG - Intergenic
1080903976 11:36522324-36522346 GACTAAAGGGGTCCAAGGTATGG + Intronic
1082085324 11:48045196-48045218 AAATAAAGAGGTTCTAAGTAAGG - Intronic
1082743297 11:56935301-56935323 TAATAAAAATATGCAATGTAAGG + Intergenic
1088052655 11:105536680-105536702 TAAACAAGAAGTCCAGTGTATGG - Intergenic
1095686067 12:45035283-45035305 TGGTAAAGAGGTCCAGTGGAAGG - Intronic
1096046480 12:48567073-48567095 TAATAAATAGTTACAATATAAGG - Intergenic
1097028205 12:56074120-56074142 TAATAAAGAAATCCTAGGTAAGG - Intergenic
1097028791 12:56077177-56077199 TAATAAAGAAATCCTAGGTAAGG + Intergenic
1098255813 12:68613954-68613976 TAATAAAGAGCTACCATGTAAGG + Intronic
1099194006 12:79593678-79593700 TAATAAAGAGTACCAATTTTAGG + Intronic
1104179261 12:126362533-126362555 TAACAAAGAGGTCTTAGGTAAGG - Intergenic
1104706169 12:130949096-130949118 TAATCAAGAGGGCCTGTGTACGG - Intergenic
1105641325 13:22268059-22268081 GAAGACAGAGGTCCAGTGTATGG + Intergenic
1108793105 13:53996608-53996630 TAATAAAGAGGTATAATGCAGGG - Intergenic
1109764598 13:66878160-66878182 TCATGAAGAGGTTAAATGTAAGG + Intronic
1109825228 13:67710333-67710355 GCATAAAGAAGTCAAATGTAGGG + Intergenic
1109912970 13:68940993-68941015 TAATATATAGGTTCATTGTAAGG + Intergenic
1110832329 13:80045635-80045657 TGAAAAAGAGTTCCAATGTTTGG - Intergenic
1111751779 13:92341868-92341890 CAATAAAAATGTCAAATGTAAGG + Intronic
1113398652 13:109971938-109971960 TAATAAATAGCTCCAGGGTAAGG - Intergenic
1114228316 14:20758532-20758554 TAAGGAAGAGGGCCAATGGAAGG + Intergenic
1114585278 14:23806420-23806442 TAAAAAAGTGGTATAATGTAGGG - Intergenic
1116299067 14:43154050-43154072 CAATAAAGTGGTAAAATGTAAGG - Intergenic
1116448892 14:45042332-45042354 TAATAAAGAGTTACAATTTTTGG - Intronic
1116516153 14:45808715-45808737 AAATCAAGATGTCCAAGGTAGGG - Intergenic
1121582396 14:95040564-95040586 AAAGAAAGATGTCCACTGTAAGG - Intergenic
1121862608 14:97332472-97332494 TAGTAAAGAGGAACTATGTATGG - Intergenic
1126220853 15:46211034-46211056 TAATAAAGGGGTCCAAAATCAGG + Intergenic
1126286595 15:47019472-47019494 AAATGCAGAGATCCAATGTAAGG + Intergenic
1130373543 15:83307965-83307987 TAAAAAAGATGTCCACAGTAAGG + Intergenic
1137037363 16:35578000-35578022 AAATAAAAAGGTCAAGTGTAGGG + Intergenic
1137913598 16:52404205-52404227 TAAGAAAGAGGGACAATGTCGGG + Intergenic
1139011163 16:62636142-62636164 TTATAAAGAGGTACTATGTGGGG - Intergenic
1140603870 16:76510529-76510551 TCCTAAAGAGGTTAAATGTAGGG - Intronic
1144180517 17:12747155-12747177 TCATAAAGAGGTCAAATGATAGG + Intronic
1150976619 17:70094580-70094602 TAATAAATAAGTGCAATGGATGG - Intronic
1155462162 18:26094943-26094965 TAATTAAGGGATCTAATGTAAGG - Intergenic
1155652579 18:28159558-28159580 TAAAAAAGGAGTCCAATGTAGGG + Intronic
1155772140 18:29714808-29714830 TAACAAAGAGGGCAAAAGTATGG - Intergenic
1157106699 18:44780756-44780778 TAATAAAGCTGTTGAATGTAAGG + Intronic
1159529335 18:69635797-69635819 TAAGAAAGAGGTGCAATGTTGGG + Intronic
1164667056 19:30047553-30047575 AAATACACAGGTCCAATGTGAGG - Intergenic
1166379799 19:42349994-42350016 CAGTAAAGAGGTCCAAGGTCTGG - Intronic
1167079423 19:47269248-47269270 TAATTAAGAGGTCTAATGTTAGG + Intronic
1167631436 19:50628523-50628545 TATGAAAGAGTTCCAATGTCAGG + Intronic
1167710022 19:51104748-51104770 TTATAAATAGGTCCGGTGTAAGG + Intronic
926395724 2:12440492-12440514 TGATTAAAAGGTCAAATGTAAGG + Intergenic
932169410 2:69539883-69539905 TAATCAAGGGGTTTAATGTATGG - Intronic
937456488 2:122045830-122045852 TTCTAAACAGGACCAATGTAGGG + Intergenic
938973715 2:136456115-136456137 TAGGAAAGAGGTCCAGTGTGGGG - Intergenic
940174250 2:150861099-150861121 TAATAAATAGATCCTATGAAAGG - Intergenic
943793201 2:191959174-191959196 TTAAAAAGAGGTTTAATGTAAGG + Intronic
1169467981 20:5858154-5858176 TGATTAAGAGGACCTATGTATGG - Intronic
1170239666 20:14149949-14149971 TAATACAGAAATACAATGTAAGG - Intronic
1170821927 20:19761444-19761466 TTCTAAAGAGTCCCAATGTATGG - Intergenic
1177252439 21:18612100-18612122 TAAGACATAGGTCCAATCTAAGG - Intergenic
1178201056 21:30405745-30405767 TAAGAAAGAGGGCCGATGAAGGG - Intronic
951038300 3:17959085-17959107 TAATAAAATAGTCCAATTTATGG - Intronic
954859288 3:53674320-53674342 TAATAAAGAATCCCAATCTAAGG - Intronic
955088133 3:55722552-55722574 AAATAAAGACATCAAATGTAGGG - Intronic
955375478 3:58392569-58392591 TATTAATGAGGTGCAATGTGAGG + Intronic
957392113 3:79589204-79589226 AATTAATTAGGTCCAATGTATGG - Intronic
957641389 3:82858142-82858164 GATGAAAGAGGTCCAAAGTATGG + Intergenic
958140105 3:89551423-89551445 TAATATAAATGTCAAATGTAAGG - Intergenic
959120614 3:102227946-102227968 TAAGAAAGATGTTCAAAGTAAGG - Intronic
963425946 3:145123755-145123777 TTATAAAGAGCTTCAATGAATGG + Intergenic
967191224 3:186986490-186986512 TAACAAGAATGTCCAATGTAGGG + Intronic
969378862 4:6781839-6781861 GAAGAAAGAGGTCCAATGGGAGG - Intronic
974437959 4:61881186-61881208 TAATAAACAGATAAAATGTAAGG - Intronic
979974637 4:127181914-127181936 TAAAAAAGAGGTACAATGCTTGG + Intergenic
980860164 4:138489893-138489915 TAATAAAAAGGTGGATTGTATGG + Intergenic
987142318 5:14959009-14959031 TAATAAAGAAGTCCAAACTCTGG - Intergenic
990068147 5:51744308-51744330 GAATAAGGAGGTCCAAGGAAAGG + Intergenic
997609327 5:135203058-135203080 TAATGAAAAGGTCCACTGTGTGG - Intronic
1000165842 5:158647987-158648009 TGATAATGAGGTCCAAGGTATGG - Intergenic
1000465302 5:161568449-161568471 TGAAATAGAGGTCTAATGTATGG + Intronic
1000668497 5:164028767-164028789 AAATAAATAGGTAAAATGTAGGG + Intergenic
1001853349 5:174989017-174989039 TGATATTGAGGTCCCATGTAGGG + Intergenic
1006545293 6:34775877-34775899 TAATATAGATGTCCAATGATGGG + Intergenic
1007708943 6:43809344-43809366 TAAAAAAGTGGTCCACAGTATGG - Intergenic
1008206110 6:48659316-48659338 TCCTAAAGTGGTCCAAAGTAGGG - Intergenic
1008399732 6:51050816-51050838 AAATAAAGATGCCCAAAGTATGG - Intergenic
1008982157 6:57497000-57497022 TAATAAAATGGCCAAATGTATGG + Intronic
1009170221 6:60389836-60389858 TAATAAAATGGCCAAATGTATGG + Intergenic
1009648051 6:66434147-66434169 TAATAAATTGGCCCAAAGTATGG + Intergenic
1013178605 6:107699166-107699188 GAATAAGGAGCTGCAATGTACGG - Intergenic
1014180260 6:118376574-118376596 TAAAAACCAGGTCCAATGAAGGG + Intergenic
1015960970 6:138649371-138649393 TTATATATAGGTCCAATTTAAGG - Intronic
1016596736 6:145811747-145811769 TAATATACTGTTCCAATGTAAGG + Intronic
1018647653 6:165962909-165962931 AAATAACTAGGTTCAATGTATGG - Intronic
1024484035 7:49895841-49895863 TAATAATGAAGTTAAATGTATGG + Intronic
1028835861 7:95374178-95374200 TAATAAAGAGGAAGAAAGTATGG - Intronic
1030816480 7:114045665-114045687 TAATTAAGAAGGCCAATGAAGGG - Intronic
1033468611 7:141622290-141622312 TAACAAAGAGGTCAAAGATAAGG - Intronic
1034476795 7:151289468-151289490 TAATGAAGAGGTCTAGGGTAAGG + Intergenic
1038979418 8:32741034-32741056 TAATAAAAAGGGCCACTGAAAGG - Intronic
1039977657 8:42381096-42381118 CAATGAAGAGGTCCAATTTGAGG + Intergenic
1042693279 8:71527638-71527660 GAATAAAGAGGACCAACTTAAGG - Intronic
1044401919 8:91782690-91782712 AAATAAAGAGGTACAAGGGATGG - Intergenic
1045539069 8:103064859-103064881 TAATAAAGAGGTCCAATGTAAGG - Intronic
1046234234 8:111401621-111401643 TAAGAAAAAGATCAAATGTATGG + Intergenic
1048146085 8:131845093-131845115 TAATAAAGAATTCCAGTTTAAGG - Intergenic
1050839135 9:10124557-10124579 TAAGAAAGAGGTCTAAGGAAGGG - Intronic
1056761265 9:89416915-89416937 TAAAAAAAAGGTCAAAGGTATGG - Intronic
1058861948 9:109125078-109125100 TAGAAGAGATGTCCAATGTATGG - Intergenic
1059913832 9:119076686-119076708 TAATAAATAGGACAAATGAATGG + Intergenic
1060685481 9:125607411-125607433 TAATATGGATGTCAAATGTATGG - Intronic
1061882576 9:133575492-133575514 TAATAAAGTGGTCCTATTTATGG + Exonic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1188480494 X:30632241-30632263 TAATAAAAATGTCCATGGTAAGG - Intergenic
1190123632 X:47684237-47684259 TAATAAATAAGTCCATTGTATGG - Intergenic
1192459749 X:71306916-71306938 TAAAAAAGAAGTCAAATGTGTGG - Intergenic
1194499873 X:94668820-94668842 CTTTAAAGAGGTCAAATGTAAGG - Intergenic
1195407552 X:104533034-104533056 TAATAAAGAGGTACATTTTGGGG - Intergenic
1196183128 X:112716930-112716952 TATTAAATAGGGGCAATGTAGGG - Intergenic
1196516031 X:116613002-116613024 TAAGAAAGAGGAACAAAGTAAGG + Intergenic
1198331447 X:135626609-135626631 TGATAAACAGGTCTAAGGTAAGG + Intergenic
1198334739 X:135655399-135655421 TGATAAACAGGTCTAAGGTAAGG - Intergenic
1198339828 X:135702855-135702877 TGATAAACAGGTCTAAGGTAAGG - Intergenic
1199047329 X:143190908-143190930 TAATAAAGAGAGCACATGTATGG + Intergenic
1202275469 Y:23114458-23114480 TTTTAAATAGGTCCAATGTCTGG - Intergenic
1202290559 Y:23306233-23306255 TTTTAAATAGGTCCAATGTCTGG + Intergenic
1202428461 Y:24748177-24748199 TTTTAAATAGGTCCAATGTCTGG - Intergenic
1202442330 Y:24921912-24921934 TTTTAAATAGGTCCAATGTCTGG + Intergenic