ID: 1045540640

View in Genome Browser
Species Human (GRCh38)
Location 8:103081030-103081052
Sequence TGTGGCATGCAGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045540640_1045540648 22 Left 1045540640 8:103081030-103081052 CCCTGCCCCTTCTGCATGCCACA No data
Right 1045540648 8:103081075-103081097 GCACCCGTCCCTCTGCACACAGG No data
1045540640_1045540651 29 Left 1045540640 8:103081030-103081052 CCCTGCCCCTTCTGCATGCCACA No data
Right 1045540651 8:103081082-103081104 TCCCTCTGCACACAGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045540640 Original CRISPR TGTGGCATGCAGAAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr