ID: 1045544267

View in Genome Browser
Species Human (GRCh38)
Location 8:103114024-103114046
Sequence CCATCTCTGCAGTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045544263_1045544267 -5 Left 1045544263 8:103114006-103114028 CCAGCTTGGGTGATGTGGCCATC No data
Right 1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG No data
1045544260_1045544267 5 Left 1045544260 8:103113996-103114018 CCCTTATTGGCCAGCTTGGGTGA No data
Right 1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG No data
1045544261_1045544267 4 Left 1045544261 8:103113997-103114019 CCTTATTGGCCAGCTTGGGTGAT No data
Right 1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG No data
1045544255_1045544267 29 Left 1045544255 8:103113972-103113994 CCTCTTTGGCCAAGAGATGGGAA No data
Right 1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG No data
1045544256_1045544267 20 Left 1045544256 8:103113981-103114003 CCAAGAGATGGGAAGCCCTTATT No data
Right 1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045544267 Original CRISPR CCATCTCTGCAGTGGGAAGC TGG Intergenic
No off target data available for this crispr