ID: 1045549183

View in Genome Browser
Species Human (GRCh38)
Location 8:103154886-103154908
Sequence TAAGAGGCCCACATCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045549183_1045549187 19 Left 1045549183 8:103154886-103154908 CCACCTGTGATGTGGGCCTCTTA 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1045549187 8:103154928-103154950 ATATATATATATAATATATATGG 0: 7
1: 74
2: 351
3: 1298
4: 4599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045549183 Original CRISPR TAAGAGGCCCACATCACAGG TGG (reversed) Intronic
901742112 1:11348887-11348909 TAAGAGGCCCTCATGCCAGTGGG - Intergenic
902460193 1:16569141-16569163 TACGAGGCCAACATTTCAGGAGG + Exonic
902780082 1:18699283-18699305 TAGGAGGCCCACCTGACAGAAGG + Intronic
913605224 1:120459440-120459462 TACGAGGCCAACATTTCAGGAGG - Intergenic
914083314 1:144429768-144429790 TACGAGGCCAACATTTCAGGAGG + Exonic
914189338 1:145395046-145395068 TACGAGGCCAACATTTCAGGAGG + Exonic
914211187 1:145580758-145580780 TACGAGGCCAACATTTCAGGAGG + Intergenic
914276390 1:146128187-146128209 TACGAGGCCAACATTTCAGGAGG + Exonic
914537434 1:148579142-148579164 TACGAGGCCAACATTTCAGGAGG + Exonic
914586350 1:149065594-149065616 TACGAGGCCAACATTTCAGGAGG + Exonic
914628492 1:149486203-149486225 TACGAGGCCAACATTTCAGGAGG - Intergenic
916363616 1:163998930-163998952 CGAGTGCCCCACATCACAGGAGG + Intergenic
917791542 1:178502418-178502440 TCAGAGGCACCCATCACATGTGG - Intergenic
919664852 1:200282338-200282360 TAAAAAACCCACACCACAGGTGG + Intergenic
924386613 1:243504580-243504602 GAAGAAGCCCATATCACATGTGG - Exonic
924564645 1:245186665-245186687 TAAGAGTCCCACTTTACAGAAGG - Intronic
924945428 1:248843189-248843211 TAGGAAGCCCAGATCACATGGGG + Intronic
1063231101 10:4066477-4066499 AAAGAGACCCACCTCACTGGTGG + Intergenic
1064130827 10:12708203-12708225 TACTAGCCCCACAGCACAGGTGG - Intronic
1067741963 10:48902217-48902239 TCAGAAACCCTCATCACAGGAGG - Intronic
1069656414 10:70092522-70092544 TAAGACGCTCACAGAACAGGAGG + Intronic
1072272013 10:93786044-93786066 CAACAGGCCCTCATCACAGCTGG + Intronic
1072985554 10:100136669-100136691 CAAGAGGCCCTCATCAGATGTGG + Intergenic
1076569948 10:131426024-131426046 GATGAAGCCAACATCACAGGAGG + Intergenic
1076738658 10:132469814-132469836 AAAGTGGCTCACAGCACAGGAGG + Intergenic
1076821399 10:132941804-132941826 GAACAGGCCCCCAGCACAGGTGG + Intronic
1077758220 11:5059400-5059422 TGAGAGACCCACATCAGTGGTGG + Exonic
1080007416 11:27424632-27424654 AAAGAAGGCCACATCACAGAGGG + Intronic
1083205481 11:61146242-61146264 TGTGAGACCCACATCAAAGGAGG + Intronic
1083931671 11:65849711-65849733 TAAGAGGCTCACTTTCCAGGAGG - Intronic
1087019632 11:93589283-93589305 TAGGAGGCCAACAAGACAGGAGG - Intergenic
1099494795 12:83334041-83334063 CAAGAGGCAGACATCATAGGGGG - Intergenic
1100191436 12:92197076-92197098 TAAGAAGCTCAAATCACATGAGG - Intergenic
1101217639 12:102600730-102600752 TTAGAGACACAAATCACAGGGGG - Intergenic
1104947277 12:132421699-132421721 TGAGAGGCTCAAACCACAGGAGG + Intergenic
1111442471 13:88297951-88297973 TAAGATGCCCACATAACCTGAGG + Intergenic
1111756535 13:92403386-92403408 GAACTGGTCCACATCACAGGAGG + Intronic
1124231591 15:27951165-27951187 TGAGAGAGCCACATCTCAGGTGG + Intronic
1129897491 15:79119197-79119219 TTTGAAGCCCATATCACAGGTGG + Intergenic
1132523914 16:404960-404982 AAAGTGGCCTTCATCACAGGAGG + Exonic
1132937094 16:2486669-2486691 GATGAGGCCCACAGCACAGAAGG - Intronic
1133912438 16:10078349-10078371 TATAATGCCCACTTCACAGGTGG + Intronic
1134625591 16:15720411-15720433 TGAGATGCCCACCTCACAAGGGG - Intronic
1135190113 16:20347949-20347971 TCTGAGGCCCACACCACAGTGGG - Intronic
1137550631 16:49435135-49435157 TTAGATGCCCACAGCACAGTGGG + Intergenic
1141525633 16:84609524-84609546 AGTGAGGCCCCCATCACAGGAGG - Intronic
1142677190 17:1521086-1521108 TAAGCTGCCCTCATCAGAGGTGG - Intronic
1144237972 17:13280922-13280944 TAAGAAGCCCACATCAGAAAAGG - Intergenic
1146161937 17:30564816-30564838 TGCCACGCCCACATCACAGGAGG + Intergenic
1147135763 17:38433482-38433504 AATGAGGCCCCCATCACTGGAGG + Intronic
1150488588 17:65560324-65560346 TAAGGGGCCCACAGCGCTGGCGG - Intronic
1155615557 18:27717198-27717220 AATGAAGGCCACATCACAGGGGG + Intergenic
1160075528 18:75671505-75671527 CAAGAGGCCCACAACGCTGGAGG + Intergenic
1160997917 19:1892840-1892862 CAAGAGAGCCACATCACTGGAGG - Intergenic
1163212619 19:15852353-15852375 TAAGAGGCCCCAATAACTGGGGG - Intergenic
1163268135 19:16233727-16233749 GCAGAGGCCCACAGCACAGCAGG - Intronic
1163439585 19:17314889-17314911 AAAGGGGCCCACAGCACAGGAGG + Intronic
1167919468 19:52771063-52771085 TAAGACGGCCAAATCACATGAGG - Intronic
1202676625 1_KI270711v1_random:12869-12891 TACGAGGCCAACATTTCAGGAGG + Intergenic
926220350 2:10932030-10932052 ACAGAGGCCCAGATCACAGCAGG + Intergenic
926712395 2:15891712-15891734 TAGGAGGCCCAGATGATAGGAGG - Intergenic
927651351 2:24915410-24915432 GATGGGGCCCACATCCCAGGAGG + Intronic
929082119 2:38131596-38131618 TCAGAGGCTCACATTCCAGGTGG + Intergenic
936008774 2:108911540-108911562 TAAGAGCCCCAGGGCACAGGGGG + Intronic
937416760 2:121721035-121721057 TGGGAGGCCAACAACACAGGTGG - Intergenic
937814899 2:126240321-126240343 CCAGAGGCATACATCACAGGTGG + Intergenic
940369875 2:152889290-152889312 GAAGGGGCCCAAATCACAGAAGG + Intergenic
945121466 2:206461830-206461852 TAACATGCCCAAATCTCAGGAGG - Intronic
945447366 2:209954154-209954176 AAAGAGGCAGACATCACAGGTGG + Exonic
1178342389 21:31796922-31796944 TAAGAAGCCCAGGTCAAAGGAGG - Intergenic
1180607259 22:17068137-17068159 TAAAATGCCCACCTCACAGGGGG + Intergenic
1180756068 22:18162080-18162102 TAAGAGGCACACATCTTTGGAGG + Intronic
1181075699 22:20375323-20375345 TAAGAGGCACACATCTTTGGAGG - Intronic
1183592279 22:38786756-38786778 GAAGAGCCTCACATCAGAGGGGG - Intronic
1184665127 22:45984427-45984449 TAAATGTCCCACATCAGAGGGGG + Intergenic
951845778 3:27082720-27082742 AATCAGGCCCACATCACAGTTGG - Intergenic
953187293 3:40650155-40650177 TAAATAGCTCACATCACAGGTGG - Intergenic
953445513 3:42961607-42961629 TAGGAGGCCCAAAACACAGTGGG + Intronic
955005707 3:54966433-54966455 CACGTGGCCCACATCACAGTAGG + Intronic
955441703 3:58962955-58962977 GAAAAGGCCAACATCACAGCTGG - Intronic
957079542 3:75624098-75624120 TAAGAGACACACATAGCAGGGGG - Intergenic
962119835 3:132549801-132549823 TTAGAGGCCCACATGACAGTAGG - Intergenic
962830181 3:139132538-139132560 AATGAGGACCCCATCACAGGTGG + Intronic
964348197 3:155776476-155776498 TAAGAGGCTCACATAACAGAAGG + Intronic
967372630 3:188764911-188764933 TAGGAGGCCAACTCCACAGGAGG + Intronic
968714170 4:2142037-2142059 CAAGAGACCCACTTCACAGGAGG - Intronic
970588510 4:17537578-17537600 TAAGTGGCCCACCTGAGAGGTGG + Intergenic
972966309 4:44514712-44514734 TAAGAAGGTCACATCACAGCTGG - Intergenic
975661697 4:76695225-76695247 AGAGAGGACCACCTCACAGGTGG - Intronic
999032771 5:148312603-148312625 TGAGATGCTCACATCGCAGGAGG - Intronic
999105174 5:149064274-149064296 TGAGAGGCCCAAAGAACAGGAGG + Intergenic
1002015237 5:176316320-176316342 TGAGAGGCTCACACCACAGGAGG - Intronic
1002468762 5:179422254-179422276 TGAGAGGCCCCCATGAGAGGAGG + Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003209430 6:4047817-4047839 TAAGAGGCCTTCATAAGAGGAGG + Intronic
1003978703 6:11368977-11368999 TAAGAGCCCTACCTCACCGGTGG - Intronic
1007697441 6:43742879-43742901 AAAGAAGCCCAGACCACAGGAGG - Intergenic
1018278009 6:162153663-162153685 AAAGAGGCCCTCAGCAGAGGGGG + Intronic
1018644805 6:165937979-165938001 ACAGACCCCCACATCACAGGAGG + Intronic
1018790896 6:167146925-167146947 TAAGAGGCACAAAGCACACGAGG + Intronic
1021155301 7:17202843-17202865 TCAGAGACACACATCAGAGGAGG + Intergenic
1022782346 7:33599139-33599161 TAAGAGGCCCAATTCACCTGGGG + Intronic
1024370235 7:48574596-48574618 TGAGAGGCCAATATCCCAGGGGG - Intronic
1027236245 7:76299683-76299705 TTTGATGCCCACATCACAGAGGG - Intergenic
1027342193 7:77221481-77221503 TGAGTGGCCCAAATCACATGTGG + Intronic
1028484097 7:91339602-91339624 TATGAGTCCCACATCACCTGGGG - Intergenic
1029438346 7:100574543-100574565 TGAGAGGCCGGCATCTCAGGAGG + Intronic
1030641704 7:112013586-112013608 TAAGAGGCCCACATGTCAAGTGG - Intronic
1033176251 7:139126614-139126636 AAAGAGGCACAGATCTCAGGAGG - Intergenic
1034987240 7:155523879-155523901 TAAGAGACCCAGACCACACGGGG + Intronic
1040752699 8:50729533-50729555 AAAGAGACCCCCATCACTGGAGG - Intronic
1045549183 8:103154886-103154908 TAAGAGGCCCACATCACAGGTGG - Intronic
1047616667 8:126568250-126568272 TAAGAGACACACAGCAAAGGAGG - Intergenic
1048892601 8:138961233-138961255 TAAGAGAGCCACATCATGGGCGG + Intergenic
1049225032 8:141446345-141446367 TAAAAGGCGCAGATCACAGATGG + Intergenic
1052269782 9:26615537-26615559 TAAGATGCCCACAGAATAGGGGG + Intergenic
1061811384 9:133164290-133164312 TCAGAGGCCCCCAGCAAAGGAGG - Intergenic
1188613531 X:32129375-32129397 TAAGAGGTCCACATCTCAAGAGG - Intronic
1189155402 X:38751462-38751484 TAGGAGGCCAGGATCACAGGGGG + Intergenic
1194603641 X:95955368-95955390 TAAGCAGCCCACAACACAGATGG - Intergenic