ID: 1045551510

View in Genome Browser
Species Human (GRCh38)
Location 8:103176935-103176957
Sequence CTGAGTTAGTTTGAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045551505_1045551510 -6 Left 1045551505 8:103176918-103176940 CCCCTTTGCTGGACTTGCTGAGT 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551499_1045551510 23 Left 1045551499 8:103176889-103176911 CCCTCGCATGCCTTCCTGCTGTG 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551506_1045551510 -7 Left 1045551506 8:103176919-103176941 CCCTTTGCTGGACTTGCTGAGTT 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551502_1045551510 9 Left 1045551502 8:103176903-103176925 CCTGCTGTGCTACCTCCCCTTTG 0: 1
1: 0
2: 0
3: 11
4: 213
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551501_1045551510 13 Left 1045551501 8:103176899-103176921 CCTTCCTGCTGTGCTACCTCCCC 0: 1
1: 0
2: 2
3: 60
4: 544
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551500_1045551510 22 Left 1045551500 8:103176890-103176912 CCTCGCATGCCTTCCTGCTGTGC 0: 1
1: 0
2: 2
3: 26
4: 236
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551504_1045551510 -3 Left 1045551504 8:103176915-103176937 CCTCCCCTTTGCTGGACTTGCTG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data
1045551507_1045551510 -8 Left 1045551507 8:103176920-103176942 CCTTTGCTGGACTTGCTGAGTTA 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045551510 Original CRISPR CTGAGTTAGTTTGAGCTGGT GGG Intronic
No off target data available for this crispr