ID: 1045552598

View in Genome Browser
Species Human (GRCh38)
Location 8:103185974-103185996
Sequence CTCTGCTTGTTCTGGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045552595_1045552598 19 Left 1045552595 8:103185932-103185954 CCCAGTCTTCATCTCTTGTTCAT 0: 1
1: 0
2: 2
3: 26
4: 353
Right 1045552598 8:103185974-103185996 CTCTGCTTGTTCTGGTGTCTTGG No data
1045552596_1045552598 18 Left 1045552596 8:103185933-103185955 CCAGTCTTCATCTCTTGTTCATA 0: 1
1: 0
2: 0
3: 29
4: 264
Right 1045552598 8:103185974-103185996 CTCTGCTTGTTCTGGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045552598 Original CRISPR CTCTGCTTGTTCTGGTGTCT TGG Intronic
No off target data available for this crispr