ID: 1045557832

View in Genome Browser
Species Human (GRCh38)
Location 8:103231885-103231907
Sequence CTGCATTAGCTGGAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045557825_1045557832 16 Left 1045557825 8:103231846-103231868 CCTTGGCTGCTTGGCCACATCTG No data
Right 1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG No data
1045557822_1045557832 25 Left 1045557822 8:103231837-103231859 CCCTTGGGGCCTTGGCTGCTTGG No data
Right 1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG No data
1045557824_1045557832 24 Left 1045557824 8:103231838-103231860 CCTTGGGGCCTTGGCTGCTTGGC No data
Right 1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG No data
1045557828_1045557832 2 Left 1045557828 8:103231860-103231882 CCACATCTGGCTGGAGCTGATGA No data
Right 1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045557832 Original CRISPR CTGCATTAGCTGGAGCTGGG AGG Intergenic
No off target data available for this crispr