ID: 1045559068

View in Genome Browser
Species Human (GRCh38)
Location 8:103243591-103243613
Sequence GGACTTTACAAAGACTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045559068_1045559075 30 Left 1045559068 8:103243591-103243613 CCATTTTAGTCTTTGTAAAGTCC No data
Right 1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG No data
1045559068_1045559070 16 Left 1045559068 8:103243591-103243613 CCATTTTAGTCTTTGTAAAGTCC No data
Right 1045559070 8:103243630-103243652 AAACCCATGCATGTCTGCTTAGG No data
1045559068_1045559074 29 Left 1045559068 8:103243591-103243613 CCATTTTAGTCTTTGTAAAGTCC No data
Right 1045559074 8:103243643-103243665 TCTGCTTAGGCAGAAGGAGCAGG No data
1045559068_1045559073 23 Left 1045559068 8:103243591-103243613 CCATTTTAGTCTTTGTAAAGTCC No data
Right 1045559073 8:103243637-103243659 TGCATGTCTGCTTAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045559068 Original CRISPR GGACTTTACAAAGACTAAAA TGG (reversed) Intergenic
No off target data available for this crispr