ID: 1045559069

View in Genome Browser
Species Human (GRCh38)
Location 8:103243612-103243634
Sequence GGTTTGTGTATCTAAACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045559069_1045559070 -5 Left 1045559069 8:103243612-103243634 CCTACAGTTTAGATACACAAACC No data
Right 1045559070 8:103243630-103243652 AAACCCATGCATGTCTGCTTAGG No data
1045559069_1045559073 2 Left 1045559069 8:103243612-103243634 CCTACAGTTTAGATACACAAACC No data
Right 1045559073 8:103243637-103243659 TGCATGTCTGCTTAGGCAGAAGG No data
1045559069_1045559074 8 Left 1045559069 8:103243612-103243634 CCTACAGTTTAGATACACAAACC No data
Right 1045559074 8:103243643-103243665 TCTGCTTAGGCAGAAGGAGCAGG No data
1045559069_1045559075 9 Left 1045559069 8:103243612-103243634 CCTACAGTTTAGATACACAAACC No data
Right 1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045559069 Original CRISPR GGTTTGTGTATCTAAACTGT AGG (reversed) Intergenic
No off target data available for this crispr