ID: 1045559075

View in Genome Browser
Species Human (GRCh38)
Location 8:103243644-103243666
Sequence CTGCTTAGGCAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045559069_1045559075 9 Left 1045559069 8:103243612-103243634 CCTACAGTTTAGATACACAAACC No data
Right 1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG No data
1045559068_1045559075 30 Left 1045559068 8:103243591-103243613 CCATTTTAGTCTTTGTAAAGTCC No data
Right 1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045559075 Original CRISPR CTGCTTAGGCAGAAGGAGCA GGG Intergenic
No off target data available for this crispr