ID: 1045559205

View in Genome Browser
Species Human (GRCh38)
Location 8:103244675-103244697
Sequence CTGTAAGCACAGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045559203_1045559205 6 Left 1045559203 8:103244646-103244668 CCTCATTAGAACAATGGAATGTG No data
Right 1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG No data
1045559200_1045559205 26 Left 1045559200 8:103244626-103244648 CCTCAGCTTCCACTCAGTCACCT No data
Right 1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG No data
1045559201_1045559205 17 Left 1045559201 8:103244635-103244657 CCACTCAGTCACCTCATTAGAAC No data
Right 1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045559205 Original CRISPR CTGTAAGCACAGAATGATGA AGG Intergenic
No off target data available for this crispr