ID: 1045564533

View in Genome Browser
Species Human (GRCh38)
Location 8:103299347-103299369
Sequence CTGTCCCGGGGGAAGGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045564533_1045564540 1 Left 1045564533 8:103299347-103299369 CCTTCGCCCTTCCCCCGGGACAG 0: 1
1: 0
2: 2
3: 21
4: 239
Right 1045564540 8:103299371-103299393 TTTGCGCACTTTCCTTTCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045564533 Original CRISPR CTGTCCCGGGGGAAGGGCGA AGG (reversed) Intronic
901242406 1:7703298-7703320 GTGACCCGGGGGGCGGGCGAGGG + Intronic
901657954 1:10781350-10781372 CTGCTCCTGGGGAAGGGCAAGGG + Intronic
905301005 1:36986101-36986123 GGGTCCCGGGGGCAGGGAGAGGG - Intronic
906344390 1:45006109-45006131 CTGTCTCTGGGGCAGGGCAATGG - Exonic
907490756 1:54807422-54807444 CTGACCCGGAGGAAGGGAGTAGG - Intronic
910876969 1:91886466-91886488 CTGTCCTGGGGGAAGCGCGAGGG + Intronic
912567297 1:110597227-110597249 GTCTCCCTGGGGAAGGGAGAAGG + Intronic
914859245 1:151372699-151372721 CTGTTCCGGGGAAGGAGCGAAGG + Exonic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915565380 1:156710022-156710044 CTGAGCCGCGGGAAGGGAGAGGG + Intergenic
915882527 1:159687137-159687159 CTGGCCAAGGGGAAGGGCCATGG - Intergenic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
916143244 1:161717932-161717954 TTGTCCAGTGGGAAGGGAGAAGG - Intergenic
920201699 1:204263457-204263479 CCTTCCCTGGGGAAGGGCCATGG + Intronic
922315133 1:224434909-224434931 CTGTCCCGGGGGTCAGGGGAGGG + Intronic
923144242 1:231186761-231186783 CAGCCTCAGGGGAAGGGCGACGG - Intronic
923211326 1:231806819-231806841 CTGGCCCTGGGGCAGAGCGAAGG + Intronic
923657545 1:235931340-235931362 TTGTCCAGGGAGAAGAGCGAAGG - Intergenic
924052440 1:240092359-240092381 CTGTCCAAGGGGAAAGGCGCCGG + Exonic
1070736278 10:78865840-78865862 CTGGCCTGGGGGAAGGCAGAAGG - Intergenic
1070768781 10:79070542-79070564 CTGTCCCCGGGGAGGGGTGGGGG - Intronic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072591647 10:96832791-96832813 CTGTACTGGGGGAGGCGCGAGGG + Intronic
1073476589 10:103757589-103757611 ATGTCGCGGGGGAAGGGCTTGGG + Intronic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1075616090 10:123891731-123891753 CTGGCGCGGGGCAAGGGCGCAGG + Exonic
1076560548 10:131360464-131360486 CAGTCCCGGGGCAGGGGCGGTGG + Intergenic
1076631257 10:131853483-131853505 CTGTCCCGTGAGCAGGGTGACGG + Intergenic
1076816159 10:132915613-132915635 CTGCCCCGAGGGACCGGCGAGGG + Intronic
1076904164 10:133354116-133354138 CTGAGCCTGGGGATGGGCGAGGG + Intergenic
1077049871 11:561744-561766 CTGTCCTGTGGGGAGGGCGCAGG - Exonic
1077147958 11:1054234-1054256 CTGGCCCGGGGGAAGTGCCTGGG - Intergenic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1080158529 11:29143215-29143237 CTGACTCGGGGGAGGGGGGAGGG - Intergenic
1081551966 11:44121832-44121854 CTGTGCTGGGGGAAGGGTTATGG - Intronic
1083242264 11:61397705-61397727 CTGGCCCAGGGGAAAGGCGTGGG - Intronic
1083305731 11:61761205-61761227 TTGTCCCGGGGAACGGGGGAGGG - Intronic
1083338672 11:61944588-61944610 ATGTCCCGGGGGAGGGGCCCGGG - Intergenic
1084849605 11:71928351-71928373 CGGTCCCGGGTGAGGGGCGTTGG - Intronic
1084978702 11:72816991-72817013 CTGTCCTGTGGGAAGGCCAAGGG - Intronic
1087225361 11:95592687-95592709 CTGTCCCGTGGGGAGGCCGTGGG + Intergenic
1087922647 11:103884130-103884152 CTGCCCAGGGGGAAGGGCTTTGG + Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089181026 11:116582926-116582948 CTGTCCCGGCGGAAGAGCAGGGG - Intergenic
1089748168 11:120631546-120631568 CTGTCCTGGGGGCAGAGGGAGGG - Intronic
1091601865 12:1922614-1922636 CTGTCCTGGGGGGGGAGCGAGGG - Intergenic
1091740673 12:2959021-2959043 CTGTCCCGGGGGCGGGGGGGTGG - Intergenic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1097014134 12:55973590-55973612 AAGTCCAGGGGGAGGGGCGAAGG + Intergenic
1098056331 12:66509791-66509813 CTGTCACGGGGGCAGGGGAAGGG + Intronic
1103602216 12:122061573-122061595 CTGTGGTGGGGGGAGGGCGAGGG - Exonic
1103810372 12:123608720-123608742 ATGTTCCGGAGGAAGGCCGAAGG + Exonic
1103856249 12:123972901-123972923 CTGTGGCGGGGCAGGGGCGAAGG + Intronic
1104761378 12:131299188-131299210 CTGTCCCGGGGGGAGAGAGGGGG - Intergenic
1104818397 12:131661604-131661626 CTGTCCCGGGGGGAGAGAGGGGG + Intergenic
1105422315 13:20264036-20264058 CTGGCCCAGGGGAAAGGCAAGGG - Intergenic
1106091315 13:26597612-26597634 CTGTTCTGGGGGAAGGCAGAGGG - Intronic
1106443226 13:29799208-29799230 CTTTGCCGGGGGCAGGGGGAAGG - Intronic
1107994850 13:45850191-45850213 CAGTCCTGGGGGAGGGGCGATGG - Intronic
1112970470 13:105255225-105255247 CTGTCACGGTGGAAGGGAAAGGG - Intergenic
1113597951 13:111547778-111547800 CTGTCCTCGGGGATGGGCGGAGG + Intergenic
1113877973 13:113606443-113606465 CTCTCCTGGTGGAAGGGCCAGGG + Intronic
1114530091 14:23390015-23390037 CTGTGCAGGGGAGAGGGCGAGGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1116696206 14:48181882-48181904 CAGTCATGGTGGAAGGGCGAAGG + Intergenic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1119429318 14:74555567-74555589 TGGTCCCGGGGGCAGGGCGTTGG + Exonic
1119804823 14:77475788-77475810 CTGACCCGTGGCAAGGGCGCCGG - Exonic
1121512200 14:94520822-94520844 CTCTCCTGGGGGAAGTGCAATGG + Intergenic
1122068269 14:99188733-99188755 CTCTCCCGGGAGGAGGGCCAGGG + Intronic
1122275005 14:100586872-100586894 CTGTCCCGGGCGGGTGGCGAGGG - Intronic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122606298 14:102948898-102948920 GTGCCCCGGGGGAAGGGACATGG + Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122999731 14:105286914-105286936 CTGGCCTGGGGCAAGGGGGACGG - Intronic
1123472637 15:20566315-20566337 CTGTCCCGGGGCAGGGGCAGTGG + Intergenic
1123645368 15:22434038-22434060 CTGTCCCGGGGCAGGGGCAGTGG - Intergenic
1123732942 15:23161306-23161328 CTGTCCCGGGGCAGGGGCAGTGG + Intergenic
1123751073 15:23358683-23358705 CTGTCCCGGGGCAGGGGCAGTGG + Intronic
1124283448 15:28382601-28382623 CTGTCCCGGGGCAGGGGCAGTGG + Intronic
1124299250 15:28529012-28529034 CTGTCCCGGGGCAGGGGCAGTGG - Intronic
1124590192 15:31046994-31047016 CTGTGCTGGGGACAGGGCGAAGG + Intronic
1125361976 15:38873900-38873922 CTGTCCCCCGGGAAGAGTGAGGG - Intergenic
1126436650 15:48644876-48644898 CCGGCCCGGGGGACGGGCGGCGG - Exonic
1126704682 15:51396198-51396220 CTGTTCCGTGGGATGGGCCAGGG + Intronic
1131180069 15:90233584-90233606 CTGTCCCGAGGGAGGGGCGGGGG - Intronic
1132466282 16:78736-78758 CTGTCCTGGGGCAAAGGAGAAGG - Intronic
1133032487 16:3017932-3017954 TTGTCCCTGGGGAGGGGGGAGGG + Intronic
1137244494 16:46691013-46691035 CTGTCCCGGGTGAAGTGTGTCGG + Exonic
1138619283 16:58198287-58198309 CTGTGGCGGCGGGAGGGCGAGGG - Intergenic
1139673964 16:68510224-68510246 CTGTCCTTGGGTAAGGGAGAGGG + Intergenic
1141068335 16:80932050-80932072 CAGACCCGGGGGGAGGGCAAGGG + Intergenic
1141645803 16:85366954-85366976 GTGTCCCCGGGGCAGGGCCAGGG + Intergenic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG + Intergenic
1144737915 17:17565161-17565183 AGGTCCTGGGGGAAGGGGGATGG - Intronic
1146674969 17:34767156-34767178 TTGTCACGGGGGAAGGGAGTTGG - Intergenic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147614256 17:41819193-41819215 CTGTCCCTGGGGAAGGGATAGGG - Exonic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1147871445 17:43590418-43590440 CTGTACTGGGGGTAGGGGGATGG - Intergenic
1150375683 17:64679797-64679819 CAGCCCCGGGGGAAGGGAGCCGG + Intergenic
1150653695 17:67025779-67025801 CTCTCCAGGAGAAAGGGCGAGGG - Intronic
1151593281 17:75061121-75061143 CTGTCCCGTGGGAAGACGGAGGG + Intronic
1151823026 17:76507245-76507267 GAGGCCCGGGGGAAGGGCGCTGG + Intergenic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152320981 17:79608807-79608829 CAGTCCTGGGGGAGGGGCGGGGG + Intergenic
1155522742 18:26685547-26685569 CTGTCCCCAGGGAAGGCCAAGGG + Intergenic
1160724752 19:613174-613196 CGGTCCCAGAGGCAGGGCGAGGG + Intronic
1161210082 19:3061718-3061740 GTGTCCCCGAGGAAGGGCGCTGG - Intronic
1161253792 19:3295208-3295230 CTGTCCTGGGGCAGGGGCGGGGG + Intronic
1162552329 19:11364625-11364647 TTGTCCCGGTGGAAGGGGGAGGG - Exonic
1162602053 19:11676858-11676880 CTGTCCAGGAGGAAGGGAGGTGG - Intergenic
1162951105 19:14072650-14072672 CTGTCCCGAGGGCGGGGCCAGGG + Intronic
1163018325 19:14470153-14470175 CTGTCCCCAGGGATGGGCTATGG + Exonic
1163263704 19:16206050-16206072 CTGTCCCGGCGGCTGGGTGAAGG - Intronic
1163828904 19:19538511-19538533 CAGTCCCCGGGGAAGCGCGTGGG - Intronic
1164923033 19:32103795-32103817 GTGTCACGGAGGAGGGGCGAGGG + Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1166688590 19:44809994-44810016 CTGTCCCCAGGGAGGGGTGACGG - Intronic
1166874216 19:45887207-45887229 CTGTCTTTGGGGAAGGGCGGAGG + Intergenic
1167455050 19:49593473-49593495 CTGCCTCGGGGGGAGGGGGAGGG - Intronic
1167614526 19:50525070-50525092 CTGTCCACGGGGAACGGCGATGG - Intronic
1167769847 19:51508394-51508416 CTGTCCTGGGGGCATGGCTATGG - Intergenic
1167978649 19:53254468-53254490 TTCTCCCTGGAGAAGGGCGAAGG + Intronic
925161137 2:1685230-1685252 CTGTCCCGGGGCAAGGGGCAGGG - Intronic
926735836 2:16072711-16072733 CTGTCCTGGAGGAAGGGCAGAGG + Intergenic
927373864 2:22390187-22390209 CTGTCCCGTGGGAGTGGCTAAGG + Intergenic
927808713 2:26170226-26170248 CTGTCCAGGGCGCAGGGAGAAGG + Intergenic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
933893611 2:86791392-86791414 ATCTCCTGGGGGAAGGGAGAGGG - Intronic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
936059354 2:109284161-109284183 CGGTCCCAGGGGAAGGGGGTTGG + Intronic
937927120 2:127175882-127175904 CTGACCCGGGCTAAGGGAGAGGG + Intergenic
937951081 2:127388191-127388213 CTGCCCCGGGGCAGGGGCGGGGG - Intronic
937987112 2:127642853-127642875 CTGGCCCAGGGTAAGGGCGGTGG - Intronic
940591157 2:155729530-155729552 CTGGCACGGGAGCAGGGCGACGG - Intergenic
946124748 2:217552805-217552827 CTTTCCCGGGGCAAAGGAGAGGG + Intronic
946159571 2:217827933-217827955 CTCTCCAGTGGGAAGGGCCATGG - Intronic
947856680 2:233328841-233328863 CTGTCCCGAGGGACTGGGGAAGG + Intronic
1169227317 20:3864817-3864839 CTGTCCCGGGGGAAGGGGCCAGG - Intronic
1169262752 20:4149662-4149684 CTGCCCTGGGGTAGGGGCGAGGG + Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171357513 20:24560658-24560680 CTGTCTCGGGGGCAGGGCAGGGG - Intronic
1171974798 20:31587715-31587737 CTGCCGCTGGGGAAGGGCGGAGG + Intergenic
1172118181 20:32583835-32583857 CCGGCCCGGGGGACGGGGGAGGG + Intronic
1172190546 20:33059657-33059679 AAGTCCCTGGGGAAGGGCAATGG - Intronic
1172426951 20:34861923-34861945 CAGTCCTGGGGGAGGGGCAAGGG - Intronic
1179893887 21:44350880-44350902 CTGTCCCGGCGGACGGGCAGGGG - Intronic
1180056350 21:45361145-45361167 GTGTCCCTGGGGCAGGGTGAGGG + Intergenic
1180188091 21:46150321-46150343 CTGTCCCGTGGGCAGGGCGGGGG - Intronic
1180207726 21:46272373-46272395 CTGAGCTGGGGGAAGAGCGATGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183233056 22:36595234-36595256 CTGTCCCTGGGGGTGGGAGAAGG + Intronic
1184403412 22:44286719-44286741 CTGGCCCTGGGGAAGGGTGTGGG - Intronic
1185121857 22:48976170-48976192 CTGTCCCCGTGGAAGGGCAGGGG - Intergenic
1185254804 22:49826427-49826449 TTGTCCCAGTGGAAGGGCCAGGG - Intronic
949896726 3:8772894-8772916 CTGTCACGGGGGCAGAGGGAGGG - Intronic
950486539 3:13277276-13277298 CTGTGCCGGGGGGAGTGAGAGGG - Intergenic
950652937 3:14418935-14418957 AAGTCCCGGGGGAAGGGGAAGGG - Intronic
950661057 3:14467240-14467262 CTGTCCAGGGGGAAGGGTGGTGG - Intronic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
953418848 3:42739465-42739487 CTGTCCCTGGGGCAGGGCTTTGG + Intronic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
960543149 3:118882656-118882678 CTGTCACTGGGGAAGGGCCATGG + Intergenic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
961513768 3:127420300-127420322 CTGTCCTGGAGGAAGGTAGAGGG + Intergenic
961633507 3:128318487-128318509 CTGTCCTGGGTGAAGGGTGCAGG - Intronic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
961779125 3:129311278-129311300 CTGTCCTGGGGCCAGGGAGAAGG + Intergenic
965404293 3:168250178-168250200 CTGTCCCGGGCGGAGCGCGGCGG + Intergenic
965813418 3:172614322-172614344 CTGGCCCGAGGGACTGGCGATGG + Intergenic
968566515 4:1316373-1316395 CTGGACAGGGGCAAGGGCGACGG - Intronic
968589094 4:1448874-1448896 CTGTTCCGAGGGCAGGGCGGGGG + Intergenic
968674583 4:1870917-1870939 CTGTCCCGTGAGAGGGGCGCGGG - Intergenic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
969121324 4:4913492-4913514 CAGGCCCTGGGGAAGGGGGAGGG + Intergenic
969344976 4:6564479-6564501 ACGTCCCGCGGGAAGGGCCAGGG + Intergenic
969615192 4:8247893-8247915 CTGTGCCGGGGGAAGTGCCCTGG + Intergenic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
983949533 4:173622825-173622847 ATGTCCCCTGGGAAGGGCAAGGG - Intergenic
985565980 5:617572-617594 CTGTCCCGGTGGCAGGGTGTGGG + Intronic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
986798540 5:11235772-11235794 CAGTCCCAGGGGAAGAGAGATGG + Intronic
989393654 5:40929351-40929373 CTGTCCTGGGGAAATGGAGAGGG - Intronic
991245671 5:64506342-64506364 CTGTCCCGGGAGCTGGGCGCTGG - Exonic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994106880 5:95959439-95959461 CTGTTCCAAGGGAAGGGCGTGGG - Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
1000902458 5:166927079-166927101 GCGTCCCGGGGGAAGGGCTCGGG - Intergenic
1001776369 5:174331958-174331980 CTGACCCTGTGGAAGGGAGAGGG + Intergenic
1001905694 5:175471036-175471058 CTGGCCAGGGGGATGGGAGAGGG + Intergenic
1002021429 5:176366309-176366331 CTTTCCCGAGGGAAGACCGAAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002280877 5:178129511-178129533 CTGTCCTGGGGAACGGGGGAAGG - Intergenic
1002306494 5:178286773-178286795 CTGCCCCGGGGGAGGGGCAGGGG - Intronic
1002636556 5:180611640-180611662 CAGTCCCGAGGGCAGAGCGAGGG - Intronic
1003050221 6:2773905-2773927 CTGTCCCTGGGTAAGGGCTGTGG + Intronic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003592270 6:7446089-7446111 CAGCCCCGAGGGAAAGGCGAGGG + Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1006803995 6:36776930-36776952 CTGCCCCTGTGAAAGGGCGATGG - Intronic
1006832567 6:36977606-36977628 CAGTCTCGGGGGAAGGGGGGTGG + Intronic
1007365180 6:41386389-41386411 CTGGCCCAGGGGAAGGGCTGAGG + Intergenic
1007371098 6:41427603-41427625 CAGGCCGGGGGGAGGGGCGAAGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1013368073 6:109449599-109449621 CTGACCTGGGGGAAGGGGGTTGG + Intronic
1015965695 6:138693437-138693459 CCGGCCCGGGGGGCGGGCGAGGG - Intergenic
1016592527 6:145762400-145762422 CTGTCACGGGCGAAGGCGGAGGG + Intergenic
1017491615 6:154950494-154950516 CGCTCCTAGGGGAAGGGCGAAGG + Intronic
1018749227 6:166788680-166788702 CTGTCCGGGGTGAGGGGCAAGGG + Intronic
1019299419 7:295947-295969 CTGGCCCTGGGGCAGGGCGGGGG - Intergenic
1019554036 7:1619788-1619810 CTGTGCTGGGGGCAGGGAGATGG + Intergenic
1019750370 7:2725345-2725367 CTGCGCGAGGGGAAGGGCGAAGG + Intronic
1019898087 7:3998567-3998589 CTGTCCAGGGGGCAGGGCCTTGG - Intronic
1020353623 7:7252636-7252658 TTGTCCTGGGGGCAGGGAGAGGG + Intergenic
1023926754 7:44675076-44675098 GTGTCCTGGGGGGAGGGGGAGGG + Intronic
1026433594 7:70372887-70372909 AAGTCATGGGGGAAGGGCGAGGG + Intronic
1027810411 7:82889285-82889307 CTGTCCTGGGGTTATGGCGAGGG - Intronic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029708416 7:102287125-102287147 GGGTCCCGGGGGAAGGACCAGGG - Intronic
1031479223 7:122258070-122258092 CTCACCCGGGGGAAGGGTGTAGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1033125004 7:138699788-138699810 CTGTTCCGGTGGCGGGGCGAGGG - Intronic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034201977 7:149288337-149288359 CTGCTTCGGGGGAAGGGAGAGGG + Intronic
1035074630 7:156169554-156169576 TTGTCCCGGGGGTAGGTGGAGGG + Intergenic
1035231731 7:157469630-157469652 CTGTCCTGGGGGAAGGGCAAGGG + Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035640990 8:1185015-1185037 CTGACCCGGGGGACGGGGGATGG + Intergenic
1035646550 8:1226467-1226489 CTGTCAGGGGGCAAGGGGGAGGG + Intergenic
1038438911 8:27558262-27558284 CTGTCCCTGAGGAAGGGGCAGGG - Intergenic
1041374022 8:57193747-57193769 TTGGGCAGGGGGAAGGGCGAGGG + Intergenic
1041382169 8:57261386-57261408 CTGGGCGGCGGGAAGGGCGAGGG + Intergenic
1041384167 8:57280499-57280521 CTGGGCTGGGGGAAGGGCGAGGG + Intergenic
1043144651 8:76637820-76637842 CTGTCGCGGGGGTGGGGAGATGG + Intergenic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1047927018 8:129691926-129691948 CTGTCCCAGGGAAAAGGCAAAGG - Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049659320 8:143812668-143812690 CTGTCCCTGGGGAGGGGAGGTGG - Intronic
1050506790 9:6357150-6357172 CTATCCTGGGGGAAGTGAGAGGG - Intergenic
1052903792 9:33817217-33817239 CTGCGCGGGGGGAGGGGCGACGG - Intergenic
1056787508 9:89603818-89603840 CTGGCGCGGGGGAAGGGCGGTGG - Intergenic
1058939293 9:109798402-109798424 GTGTCCCAGGGGAATGGCTAAGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061765624 9:132879138-132879160 CTGTCTCGGGGTGGGGGCGAGGG + Intronic
1062264386 9:135680003-135680025 CTGACCTGGGGGTAGGGGGAGGG - Intergenic
1062341207 9:136094744-136094766 CTGGCCCGGGGCCAGGGCGGAGG - Intronic
1062389183 9:136327362-136327384 CAGTCCCCGGGGAGGGGGGAGGG - Intergenic
1190879970 X:54484999-54485021 CTGTCCCTGGGGGAGGGCCCAGG - Intronic
1199964478 X:152808136-152808158 CAGTGCCGGGGGTAGGGGGAGGG - Intergenic