ID: 1045574296

View in Genome Browser
Species Human (GRCh38)
Location 8:103402851-103402873
Sequence AGACCACAGCTTCCAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045574291_1045574296 -10 Left 1045574291 8:103402838-103402860 CCAGGTCCCCAAGAGACCACAGC 0: 1
1: 0
2: 3
3: 29
4: 345
Right 1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG No data
1045574289_1045574296 5 Left 1045574289 8:103402823-103402845 CCAGACTACATTATCCCAGGTCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG No data
1045574287_1045574296 30 Left 1045574287 8:103402798-103402820 CCTGTTAGAACTGCTAATGTCTT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG No data
1045574290_1045574296 -9 Left 1045574290 8:103402837-103402859 CCCAGGTCCCCAAGAGACCACAG 0: 1
1: 0
2: 4
3: 26
4: 290
Right 1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045574296 Original CRISPR AGACCACAGCTTCCAAGGAA TGG Intronic
No off target data available for this crispr