ID: 1045576637

View in Genome Browser
Species Human (GRCh38)
Location 8:103428976-103428998
Sequence CTTTCCATTAAGTTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045576637_1045576640 0 Left 1045576637 8:103428976-103428998 CCTGTTTTAAACTTAATGGAAAG 0: 1
1: 0
2: 4
3: 16
4: 237
Right 1045576640 8:103428999-103429021 GGCATGTTGCTGTGAACAAATGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045576637 Original CRISPR CTTTCCATTAAGTTTAAAAC AGG (reversed) Intronic
902828585 1:18995043-18995065 CTTTCCATTTGGGTTATAACTGG + Intergenic
905139957 1:35835357-35835379 CATTTTATAAAGTTTAAAACTGG - Intronic
905548934 1:38820525-38820547 ATTTACATAAAGTTTAAAGCAGG + Intergenic
907220345 1:52903003-52903025 ATTTCCATAAAGATTAAAAGTGG - Intronic
907672481 1:56488629-56488651 ATTTTTATAAAGTTTAAAACAGG - Intergenic
909654300 1:78013437-78013459 CTTACCATTGAGATTAAAAAAGG + Exonic
911269243 1:95780590-95780612 CTTTCTATCACCTTTAAAACAGG + Intergenic
911363631 1:96910304-96910326 CTTTCCATTAATGTTAAAGGAGG + Intergenic
912593538 1:110851442-110851464 CTTTCCCTGAAGTTAAAACCAGG + Intergenic
912626180 1:111206021-111206043 ATTTGTATAAAGTTTAAAACAGG + Intronic
914340630 1:146756749-146756771 CTTTCCATTTACTTAAATACAGG - Intergenic
918417206 1:184322801-184322823 CTTTCTTTTTAGTTTAAAAAAGG + Intergenic
918687994 1:187443705-187443727 CTTTCCTTTTATTTTTAAACAGG + Intergenic
919329375 1:196150000-196150022 CTTTGTATTAAGTTTTAAATTGG - Intergenic
920553013 1:206880683-206880705 CTTTGTAATAAGTTTGAAACTGG - Intergenic
923692532 1:236209257-236209279 CTTTCATTTAAGTAAAAAACAGG + Intronic
923901401 1:238329587-238329609 CTTTCTATTAACTTTCAATCTGG - Intergenic
924398000 1:243644471-243644493 ATTTCCCTTAACTATAAAACAGG + Intronic
924403454 1:243715716-243715738 CTTTTCATTATTTTGAAAACAGG + Intronic
1063293269 10:4773904-4773926 CTTTCCCTTAAGATTAGAAATGG + Intergenic
1063839845 10:10058371-10058393 CTTTCAATTAAGTTTAATTTAGG - Intergenic
1064901260 10:20298051-20298073 CTTCCCATTGAGTTGAGAACCGG + Intergenic
1065070555 10:22019685-22019707 CTTTTCATTTTGTTTATAACAGG - Intergenic
1065453242 10:25880462-25880484 CTTTTTATAAAGTTTAAAATAGG - Intergenic
1068346609 10:55787991-55788013 GTTACCATAATGTTTAAAACAGG + Intergenic
1069125333 10:64624584-64624606 ATTTACATAAAGTTTGAAACAGG + Intergenic
1069226171 10:65947665-65947687 CTTGCGTTTAAGTTTAATACAGG - Intronic
1072087319 10:92093457-92093479 TTTTGAATTAACTTTAAAACTGG + Intronic
1072468212 10:95687199-95687221 CTTTTCATTCAATTTAAAACAGG - Intronic
1072983402 10:100118440-100118462 CTTTCGTTTCAGTTTAAAAATGG - Intergenic
1072985202 10:100133400-100133422 TTTTACATTAATTTTAAAACTGG - Intergenic
1073160395 10:101388794-101388816 CTTAACATTAAGAATAAAACAGG - Intronic
1073673228 10:105615628-105615650 CTTCCCATAAAGAATAAAACAGG - Intergenic
1073819033 10:107238845-107238867 CTTTTCATTAATTTTAAAGAAGG + Intergenic
1073940877 10:108696458-108696480 CTTTCCATTCCCTTTAAGACAGG + Intergenic
1075365938 10:121888896-121888918 ACTTACATTAAGTATAAAACAGG + Intronic
1077403763 11:2372862-2372884 CTTTGCAGTAAGTTTGAATCAGG + Intergenic
1078423721 11:11232833-11232855 CTTTCTTTTTAATTTAAAACTGG + Intergenic
1079870294 11:25790376-25790398 CTTTTCATTAAATTTAATATTGG + Intergenic
1080284637 11:30595403-30595425 CTTTGCATTAGGTGTAACACTGG - Intergenic
1080540977 11:33265120-33265142 CTTTCTATTGAGTTTAAATAGGG + Intronic
1080927727 11:36775496-36775518 ATTTCAATTCTGTTTAAAACTGG + Intergenic
1081578785 11:44337295-44337317 CTTTCCATGAAGAGGAAAACAGG + Intergenic
1083819742 11:65162133-65162155 CTTTGTAGTAAGTTTAAAATTGG - Intergenic
1085725420 11:78950759-78950781 TTTTCCCTTATGTGTAAAACAGG - Intronic
1086645656 11:89216809-89216831 CTTTCGATTAGGGTGAAAACAGG - Intronic
1087132278 11:94678673-94678695 CTTTCCATTTAGTGGAATACTGG + Intergenic
1087470812 11:98571936-98571958 ATTTCCATTAAGTAAAAAAAGGG - Intergenic
1087599543 11:100295197-100295219 CTTTACATTAAGTTGAAGATGGG + Intronic
1088345674 11:108822026-108822048 ATTTCCATTAAGTTTTAAGATGG + Intronic
1088681737 11:112249434-112249456 CTTTCCATTAACTTTAAAGCAGG - Intronic
1091963962 12:4722505-4722527 CTTACCCTTAAGTTTAAATGAGG - Intronic
1094000696 12:25690832-25690854 CTTTCCATTTAGAGAAAAACTGG + Intergenic
1097490642 12:60265707-60265729 CTTTCCAATTAATTTAATACAGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098855913 12:75653124-75653146 CTTTCTATTAACTTTCAAATAGG + Intergenic
1104073037 12:125363174-125363196 TTTACACTTAAGTTTAAAACTGG - Intronic
1105783748 13:23727341-23727363 CTTTCCACTATGTTTTAATCTGG + Intergenic
1106701553 13:32234490-32234512 GTTACCTCTAAGTTTAAAACAGG - Intronic
1108542783 13:51459868-51459890 CTTTCCAATATTTCTAAAACTGG - Intergenic
1108928443 13:55783691-55783713 ATTTCCATTAAAACTAAAACTGG - Intergenic
1110303175 13:73953059-73953081 TTTTCCACTAAGGTTAAGACAGG + Intronic
1110908184 13:80919107-80919129 CATACCATTAGTTTTAAAACAGG + Intergenic
1111077164 13:83252053-83252075 CATTACATAAAGTTTTAAACTGG + Intergenic
1112515978 13:100053421-100053443 ATTTATATAAAGTTTAAAACAGG - Intergenic
1114150232 14:20030639-20030661 CTTTCCCTTAATTTTAACCCTGG + Intergenic
1114338624 14:21719412-21719434 CTTTCCTTGTAGTTTAAAATAGG - Intergenic
1114705698 14:24724730-24724752 ATTTCGATTAAATTTTAAACAGG + Intergenic
1115788905 14:36857095-36857117 ATTTCCATTAAAATAAAAACAGG - Intronic
1116248548 14:42452479-42452501 CTTTCTATGGAGTTTAAAACAGG + Intergenic
1116536883 14:46042322-46042344 ATTTCTGTGAAGTTTAAAACAGG - Intergenic
1116581854 14:46652088-46652110 CTTTGCTTTAAGTATAAAAGAGG + Intergenic
1117704908 14:58455243-58455265 CTTTCCTTTAATTTTAAAACTGG + Intronic
1117858840 14:60067797-60067819 CTATCAATTTGGTTTAAAACAGG + Intergenic
1119081101 14:71694692-71694714 CTTTCCATTCTGTTGAATACAGG - Intronic
1123662754 15:22579056-22579078 TTTTGCATTAGGTTTAAAATAGG - Intergenic
1124261530 15:28196859-28196881 TTTTGCATTAGGTTTAAAATAGG + Intronic
1124316555 15:28673360-28673382 TTTTGCATTAGGTTTAAAATAGG - Intergenic
1126237910 15:46407156-46407178 CTTTCCATTATATTCAATACAGG + Intergenic
1127722769 15:61719202-61719224 CTTTCCATCAAGATAAGAACAGG + Intergenic
1136995178 16:35184169-35184191 CTTTCCATTAAGCTGAGCACAGG + Intergenic
1139993655 16:70960657-70960679 CTTTCCATTTACTTAAATACAGG + Intronic
1143831917 17:9659356-9659378 ATTTCCATTAACTGTAAAATAGG - Intronic
1145789758 17:27618994-27619016 TTTTCCTTAAAGTTTATAACTGG - Intronic
1148399948 17:47349696-47349718 CATTCCATTAACTATAAAAATGG - Intronic
1149138071 17:53394441-53394463 CATTGCATTGAGTTTAAAATTGG - Intergenic
1153204852 18:2687820-2687842 CTTTCCATTGAGTTTAATAGTGG + Intronic
1155378879 18:25194822-25194844 CTTTCCATAGAGTTTTAGACAGG - Intronic
1156577073 18:38329453-38329475 ATTTCCATAGAGTTTAAAATTGG - Intergenic
1157036348 18:43979654-43979676 CTTTCCATCCAGTTTAGAATTGG - Intergenic
1157387736 18:47273351-47273373 TTGTCTTTTAAGTTTAAAACTGG - Intergenic
1158061681 18:53350573-53350595 CTCTCCATAATGTTTAATACTGG + Intronic
1158354566 18:56602771-56602793 CTTTCCATGTATTTGAAAACTGG - Exonic
1160497759 18:79385151-79385173 TTTTCCATTAAGTTTTGAACCGG - Intergenic
1165722906 19:38092465-38092487 CTGTTCACTAAGTTTGAAACTGG + Intronic
925557439 2:5147215-5147237 CATTCCATTAAGACTAAGACTGG + Intergenic
926465798 2:13185441-13185463 CTTTCCATTATGAATAAAATAGG - Intergenic
927858727 2:26544398-26544420 TTTTATATGAAGTTTAAAACAGG - Intronic
928907736 2:36385153-36385175 CTTGCCATTAACTCTAATACTGG - Intronic
929766849 2:44850896-44850918 CTTTACATTAACTTTATACCCGG - Intergenic
930626628 2:53706119-53706141 CATTCCATTATCTTTAAAATAGG - Intronic
930924873 2:56804939-56804961 CTTTCCATTGAATTTAAATTTGG - Intergenic
931374523 2:61695310-61695332 TTTTCCTTTAAGTAGAAAACTGG + Intergenic
932843606 2:75110949-75110971 ATTTTCATTAAGTTTAACATGGG + Intronic
933357966 2:81238018-81238040 CTTTACATTAAGATAAAAAGGGG + Intergenic
935859642 2:107314804-107314826 TTTTCCTGTAAGTCTAAAACTGG - Intergenic
936664896 2:114583120-114583142 CATACAATTAAATTTAAAACAGG - Intronic
938869997 2:135465240-135465262 GTTTACATGAACTTTAAAACAGG - Intronic
938870012 2:135465383-135465405 GTTTACATGAACTTTAAAACAGG - Intronic
940452461 2:153857016-153857038 CTTTATATTAAGTTCAAAATAGG + Intergenic
940932973 2:159457803-159457825 GTTTCCTTTAAGGTTAACACAGG - Intronic
941465916 2:165826835-165826857 CTTTCCTTGAAGTTTAAGACAGG + Intergenic
942330692 2:174820824-174820846 CTTTACATGATGTTTAAAAAAGG + Intronic
942599997 2:177631128-177631150 CTTTCTATTATGTTTCTAACTGG + Intronic
942965250 2:181884753-181884775 CTTTCCAATTATTTTTAAACAGG - Intergenic
943009046 2:182424313-182424335 ATGTCCATTAAGCTTATAACTGG + Intronic
944023490 2:195135687-195135709 TTTTCCATAAAGTTTGAAAAGGG + Intergenic
944284385 2:197931764-197931786 CTTCCCACTGAATTTAAAACTGG - Intronic
945883082 2:215346858-215346880 CTTTCGATGAAGTTTAAAACAGG + Exonic
946996295 2:225395806-225395828 ATTTCTAGTAAGTTTCAAACTGG + Intergenic
948006967 2:234617565-234617587 CTTCCCATTAATCCTAAAACTGG - Intergenic
948651963 2:239452514-239452536 CTTTAAAACAAGTTTAAAACTGG + Intergenic
1170902851 20:20483015-20483037 CTTTCCATTAAGTAAAAGATGGG - Intronic
1171435820 20:25123399-25123421 CTTTGCAGTAAGTTTGAAATTGG - Intergenic
1171478045 20:25428915-25428937 CTTTGCAGTAAGTTTAAATTAGG + Intronic
1177660997 21:24084296-24084318 CTTTCCATTAAGTCTCTAAGAGG + Intergenic
1178885468 21:36481472-36481494 CATTACATTTAGTTTACAACTGG + Intronic
1179504854 21:41833618-41833640 CTTTCTGTTCAGTCTAAAACGGG + Intronic
1182040046 22:27231182-27231204 TTTCCCAATACGTTTAAAACAGG - Intergenic
1184690747 22:46116229-46116251 GTTTCCATTTCTTTTAAAACGGG + Intergenic
949358466 3:3206467-3206489 GATTCCAATAATTTTAAAACTGG + Intergenic
950255633 3:11502918-11502940 CTTTCTGTTAAGGGTAAAACAGG + Intronic
951886288 3:27527772-27527794 TTTTCCATTATGGTTAAAAATGG - Intergenic
952759653 3:36902985-36903007 CTTTCCATTCCTTTTAAAAGTGG - Intronic
953826177 3:46252871-46252893 CTTTCCACTACATTTAAAATAGG + Intronic
957338792 3:78866167-78866189 CTTATAATTAAATTTAAAACAGG + Intronic
961106734 3:124249016-124249038 CTTTCCTCCAAGTTCAAAACAGG - Intronic
962154190 3:132927257-132927279 TTTTAAATTAAGTTTAGAACTGG - Intergenic
963238434 3:142978548-142978570 CTTTCCATAAATTTAACAACTGG + Intronic
963386937 3:144609251-144609273 GTTTCCTTTATATTTAAAACAGG - Intergenic
963718084 3:148827303-148827325 ATTTACATTAAGTTTAATACAGG + Intronic
965037664 3:163462667-163462689 CTTCACAGTAAGTTTAAAATAGG + Intergenic
965568749 3:170149938-170149960 CTTTCCATTAGTTTTAATAGGGG + Intronic
965632891 3:170751571-170751593 ATTTCCATCAAGTGCAAAACTGG + Intronic
966315659 3:178642897-178642919 ATTTCCATAACATTTAAAACAGG - Intronic
967069558 3:185950617-185950639 CCTTCTATTAAGTCTTAAACTGG + Intergenic
970411854 4:15816652-15816674 CATGCCATTGATTTTAAAACTGG + Intronic
971114394 4:23628069-23628091 CTTTTCATTATCTTTAAAGCAGG - Intergenic
971392263 4:26197297-26197319 CTTTCCATCATGTGTAAAATGGG + Intronic
971542047 4:27831236-27831258 CTTTCCATCAGGTGAAAAACTGG + Intergenic
972138675 4:35927420-35927442 CTTTCCTTGAAATTTGAAACTGG + Intergenic
973106679 4:46347640-46347662 CTTTCCCTTATGTTTTAATCTGG - Intronic
974242715 4:59271803-59271825 CTTACCATAAAGTGTAAAAAGGG - Intergenic
974736686 4:65944553-65944575 CTTTCCATTATATTTAAAGCTGG - Intergenic
976164229 4:82237016-82237038 CTTTCCATTAATTTTTAATGTGG - Intergenic
976402112 4:84619222-84619244 TTTGAAATTAAGTTTAAAACAGG + Intronic
977427366 4:96885066-96885088 CTTTCCAATAAATTAAAAAATGG + Intergenic
978455652 4:108887604-108887626 CTCTCAATATAGTTTAAAACTGG + Intronic
978877086 4:113654230-113654252 CTTTTCCTAAAATTTAAAACTGG - Intronic
978893993 4:113863898-113863920 CTATCCATTTAGTTGAGAACTGG - Intergenic
979050636 4:115926908-115926930 CTTTCACTTAATTTTAATACTGG - Intergenic
979209587 4:118083282-118083304 ATTTCCATTTAGTTTAAGAAAGG - Intronic
979955832 4:126952911-126952933 CTCTACATTAATTTTAAAAAAGG - Intergenic
980736580 4:136898070-136898092 CTTACCATTTAGTTTAAATGTGG + Intergenic
980800847 4:137747809-137747831 CTTTCCATTGAGCATAAAAAAGG - Intergenic
980902518 4:138918470-138918492 CTTTGCATTAAGTGACAAACTGG - Intergenic
981215473 4:142160760-142160782 CTCAGCATTAACTTTAAAACAGG - Intronic
982519012 4:156389626-156389648 CTATCCATTTACTTTTAAACTGG - Intergenic
983305417 4:165978713-165978735 CTTTGCATTAAGTTGTAAATTGG + Intronic
983311785 4:166073995-166074017 CTGTCCATTAACGTCAAAACTGG - Intronic
983727725 4:170949865-170949887 CTTTCATTTAAATTTAAAAATGG - Intergenic
984540731 4:181034044-181034066 CATTCCAATAATTTTTAAACTGG - Intergenic
987192908 5:15497734-15497756 CTTTCCATTTTGTTTTAAGCTGG + Intergenic
992795614 5:80252973-80252995 ATTTCCATTAAATTTATAATAGG + Intronic
994005584 5:94833521-94833543 TTTTCCATTAAATATAAAAATGG - Intronic
994785447 5:104155559-104155581 CTTTACAATAAGTATAATACAGG - Intergenic
995287337 5:110405269-110405291 CCTTCCCTTAACTTTCAAACAGG + Intronic
995508309 5:112883085-112883107 ATTCCCATTAATTTTCAAACAGG + Intronic
996545199 5:124670641-124670663 CTTTTCATTAAGTTTATCAAAGG + Intronic
996865721 5:128119375-128119397 CTATGCATCAAGTTTAAAATGGG - Intronic
1000958142 5:167566721-167566743 CTCTCCATTGAGTTGAATACAGG - Intronic
1001318018 5:170658036-170658058 CTTTCCATTAGGTTCAACTCAGG - Intronic
1001887501 5:175308087-175308109 GTTTCCATAAATTTTAAAATTGG + Intergenic
1003011570 6:2432176-2432198 GTTTCTATGAAGTTCAAAACTGG + Intergenic
1003250499 6:4425727-4425749 CTTTACAGTAAGTTTAAAGTTGG - Intergenic
1003303894 6:4909222-4909244 GTTTACAATAAGTTTAATACAGG - Intronic
1003342372 6:5234025-5234047 CATTTCATTTGGTTTAAAACGGG + Intronic
1005073794 6:21887773-21887795 TTTTCCACTGAGTTTAAAAAAGG + Intergenic
1005165391 6:22914100-22914122 CTTTGCATTAACTTGATAACTGG - Intergenic
1006830978 6:36968184-36968206 CTTACCATGAACTTTAAAACTGG + Exonic
1009831563 6:68943179-68943201 TTTTCCATTCATTTTGAAACAGG + Intronic
1010326706 6:74571690-74571712 TTTACCATTAAGCATAAAACTGG - Intergenic
1010575820 6:77528996-77529018 CTTTGCATTTATTTTAAAAATGG + Intergenic
1010812997 6:80321642-80321664 CTTTGCCTAAAGTTTAAAACAGG + Intronic
1010837622 6:80609743-80609765 CTTTCCCTTTTGTTTCAAACAGG + Intergenic
1013663107 6:112318751-112318773 CTATCAATTACATTTAAAACTGG + Intergenic
1013768936 6:113605595-113605617 CTTTCCATTGAGTTTCAGTCTGG - Intergenic
1014632928 6:123809722-123809744 CTTTCCTTGAATTATAAAACAGG + Intronic
1015270225 6:131330357-131330379 CTTTCCATTTAGTTTCAGAGTGG + Intergenic
1015500690 6:133930584-133930606 TTTTGCATTATGATTAAAACTGG + Intergenic
1017699534 6:157054959-157054981 TTTTCCATTCAGTTTAGAACTGG + Intronic
1020924259 7:14304791-14304813 GTTTTCATTAGGATTAAAACAGG - Intronic
1021180671 7:17501592-17501614 CCTTCAATTAAGTTCAAAATTGG + Intergenic
1021391620 7:20100296-20100318 CTTGCCATTAATTTTAACAGCGG - Intergenic
1023008669 7:35905055-35905077 CTTACCATAAAGTGTAAAAAGGG - Exonic
1023016603 7:35974432-35974454 CTTACCATAAAGTGTAAAAAGGG - Intergenic
1024122379 7:46257663-46257685 CTTTCCATCATATTTCAAACTGG + Intergenic
1025071446 7:55903119-55903141 CTTTCCTGTAAGTCTAAAATGGG + Intronic
1026409725 7:70107641-70107663 CTCACAATTAAGTTTATAACAGG + Intronic
1027564768 7:79777716-79777738 CTTTCCATGAAGTATAGAAAAGG + Intergenic
1027737152 7:81947262-81947284 CCTTTTATTAACTTTAAAACTGG - Exonic
1027961280 7:84948875-84948897 CTTTCCATTTAATTAAGAACAGG + Intergenic
1027991884 7:85373269-85373291 ATTTCCATTGTATTTAAAACAGG - Intergenic
1028732422 7:94166593-94166615 CTTTCCCTTACTTCTAAAACTGG + Intergenic
1029064132 7:97831295-97831317 TTTTCTAGTAAGTTTAAAAAGGG - Intergenic
1030858530 7:114592763-114592785 CATTCAATTATGTTTAAAATTGG + Intronic
1031007529 7:116490708-116490730 CTTTACAAAAAATTTAAAACAGG + Intronic
1031382788 7:121108959-121108981 CTGTACAGTAATTTTAAAACTGG - Intronic
1032060562 7:128720868-128720890 CTTTATATTAAGTTTGAAAATGG + Intronic
1032457248 7:132082684-132082706 CTTTCCAATAAAAATAAAACCGG + Intergenic
1032644186 7:133803285-133803307 TTTTCCATTACTTTGAAAACAGG + Intronic
1033512548 7:142073996-142074018 ATTTCCATCAAATTTCAAACTGG - Intronic
1034712174 7:153203322-153203344 ATTTCCATTAAGAAAAAAACTGG + Intergenic
1035150355 7:156865666-156865688 CTTTGTAGTAAGTTTAAAATTGG - Intronic
1036511311 8:9402917-9402939 CCTTCCCTTAATTTTAAAAGAGG - Intergenic
1038130385 8:24723968-24723990 ATTTCTATTAAGTCTAAAAAAGG + Intergenic
1038284520 8:26194999-26195021 GTTAGCATTAAGTTTAAAAGAGG - Intergenic
1039387836 8:37152218-37152240 CTTACCATGAACTTGAAAACAGG + Intergenic
1039628551 8:39081622-39081644 TTTTCCATTAATTTTTAAATAGG - Intronic
1039648184 8:39310160-39310182 CTTTCCATTCAGTTTACTGCTGG + Intergenic
1040775865 8:51042643-51042665 GTTAACATTATGTTTAAAACAGG + Intergenic
1040897746 8:52386661-52386683 CTTTCCTTTTATTTTAAAAGGGG + Intronic
1042219304 8:66457791-66457813 CTTTCCCTTGAGATAAAAACAGG - Intronic
1042267275 8:66921875-66921897 CTTTCGAATATGTTCAAAACAGG + Exonic
1042958083 8:74273051-74273073 CTTTCCATTATGTTTAGAGAAGG - Intronic
1045222323 8:100211346-100211368 CTTTGCATTCAGTTCAAATCTGG + Intronic
1045576637 8:103428976-103428998 CTTTCCATTAAGTTTAAAACAGG - Intronic
1048038671 8:130703826-130703848 TTTTCTATTAAGTTTCTAACTGG - Intergenic
1048483206 8:134821035-134821057 CTTTCCACTAAGTCTAGAATTGG - Intergenic
1049246775 8:141567093-141567115 TTTTCAACTAAGTTTAAAACCGG - Intergenic
1050851228 9:10289081-10289103 CTTTTCATTAAATTTGAAACTGG - Intronic
1051232007 9:14964364-14964386 CTGTTCATTATATTTAAAACGGG - Intergenic
1052184571 9:25576722-25576744 CTTTTCATTCAGTGTAAAACAGG - Intergenic
1052767698 9:32658467-32658489 CTTTCCATTAGGTTCCATACTGG + Intergenic
1053192023 9:36079864-36079886 CTTTACATTGACTTTAATACAGG + Intronic
1056152985 9:83805766-83805788 CATTGCATAAAGTTTAAAATAGG - Intronic
1057734524 9:97643102-97643124 CATTCCATTAACTTTGGAACAGG - Intronic
1060563265 9:124566209-124566231 ATTTGTATTAAGCTTAAAACAGG + Intronic
1185976173 X:4723105-4723127 ATTTCCTTTAACTTGAAAACAGG - Intergenic
1186725232 X:12350653-12350675 CTTTGTAATAAGTTAAAAACAGG + Intronic
1186962806 X:14755499-14755521 TTTTCCATTAAGTTTGGTACTGG - Intergenic
1187372789 X:18724722-18724744 CTGTCCAATAAGTTTAGAACTGG + Intronic
1188880771 X:35489349-35489371 GTCTCCATTGAGTTTAAAGCAGG - Intergenic
1197038941 X:121910907-121910929 CTTTCTAGTAAGTTTAAAACTGG + Intergenic
1199453768 X:148004090-148004112 TGTTACATTAAGTTTAAAACAGG + Intronic
1200225995 X:154418106-154418128 CTATCCATTGAGCTTGAAACTGG - Intronic
1200801982 Y:7395172-7395194 CTTTCAATTAGGTTTCAAATAGG - Intergenic
1201567402 Y:15381114-15381136 CTTTCCTTTCAGAATAAAACAGG + Intergenic