ID: 1045578668

View in Genome Browser
Species Human (GRCh38)
Location 8:103453962-103453984
Sequence AAGAATAAGGTGAAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045578662_1045578668 0 Left 1045578662 8:103453939-103453961 CCATATTGTGACCATGAGTCCAA No data
Right 1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG No data
1045578661_1045578668 16 Left 1045578661 8:103453923-103453945 CCTGTTACTGTGGTGACCATATT No data
Right 1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG No data
1045578660_1045578668 23 Left 1045578660 8:103453916-103453938 CCTGATACCTGTTACTGTGGTGA No data
Right 1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045578668 Original CRISPR AAGAATAAGGTGAAGGATGG TGG Intergenic
No off target data available for this crispr