ID: 1045582620

View in Genome Browser
Species Human (GRCh38)
Location 8:103498531-103498553
Sequence CCTGGGGAACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045582608_1045582620 14 Left 1045582608 8:103498494-103498516 CCCCAGCTCTCTTAAATGGGGAG No data
Right 1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG No data
1045582604_1045582620 19 Left 1045582604 8:103498489-103498511 CCTGTCCCCAGCTCTCTTAAATG No data
Right 1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG No data
1045582609_1045582620 13 Left 1045582609 8:103498495-103498517 CCCAGCTCTCTTAAATGGGGAGC No data
Right 1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG No data
1045582610_1045582620 12 Left 1045582610 8:103498496-103498518 CCAGCTCTCTTAAATGGGGAGCT No data
Right 1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045582620 Original CRISPR CCTGGGGAACAGAGGGAGGA GGG Intergenic
No off target data available for this crispr