ID: 1045582718

View in Genome Browser
Species Human (GRCh38)
Location 8:103499092-103499114
Sequence AGCGACCACTGGAGGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045582718_1045582721 -3 Left 1045582718 8:103499092-103499114 CCTCACAGCCTCCAGTGGTCGCT No data
Right 1045582721 8:103499112-103499134 GCTTCATCTTCGCACCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045582718 Original CRISPR AGCGACCACTGGAGGCTGTG AGG (reversed) Intergenic
No off target data available for this crispr