ID: 1045587833

View in Genome Browser
Species Human (GRCh38)
Location 8:103559254-103559276
Sequence GAAAATCAGGATCAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045587833_1045587837 1 Left 1045587833 8:103559254-103559276 CCAGCCTTCTGATCCTGATTTTC 0: 1
1: 0
2: 6
3: 30
4: 275
Right 1045587837 8:103559278-103559300 TAATTAGCCTTCCCATTAGCAGG 0: 1
1: 1
2: 0
3: 15
4: 259
1045587833_1045587838 2 Left 1045587833 8:103559254-103559276 CCAGCCTTCTGATCCTGATTTTC 0: 1
1: 0
2: 6
3: 30
4: 275
Right 1045587838 8:103559279-103559301 AATTAGCCTTCCCATTAGCAGGG 0: 1
1: 1
2: 1
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045587833 Original CRISPR GAAAATCAGGATCAGAAGGC TGG (reversed) Intronic
901812760 1:11777130-11777152 GAAACTGAGGCTCAGAGGGCTGG + Intronic
902088004 1:13877931-13877953 TAAAAGCAGGATCATGAGGCAGG - Intergenic
902906812 1:19564277-19564299 GAAATTCAGGACCAGAGGCCTGG + Intergenic
903679103 1:25085184-25085206 GAAAAGCAGGAGCAGAATCCAGG - Intergenic
904850400 1:33454967-33454989 TGAAATCAGGCTCAGAAGGGTGG + Intergenic
904871044 1:33618438-33618460 GAACATCAGGATGAGAAAGTTGG - Intronic
905775243 1:40664124-40664146 GGCAGTCAGGAACAGAAGGCAGG + Intronic
906843393 1:49163981-49164003 GAAAACCAGGATAGGAAGGGAGG + Intronic
907334369 1:53690682-53690704 GAAAATGAGACTCAGGAGGCAGG + Intronic
909287569 1:73839040-73839062 GAACATCAGTAACACAAGGCTGG - Intergenic
910235221 1:85028695-85028717 GAAACTAAGGCTCAGAAGCCAGG - Intronic
910756965 1:90704495-90704517 AAAAATCAGGAGGACAAGGCAGG + Intergenic
912452203 1:109774109-109774131 GAAAGTGAGGTTCAGAAGTCAGG - Intronic
912827650 1:112920841-112920863 AAAATTCAACATCAGAAGGCCGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913497640 1:119443078-119443100 GGAAATGAGGATCAGAAAGAAGG + Intergenic
913508708 1:119542995-119543017 GAAAATGAGAATCAGAAAGAAGG + Intergenic
914682486 1:149948664-149948686 GAAAATCAGGATAATCAGGCCGG - Intronic
914855766 1:151349262-151349284 TAGAATCAGGATCCAAAGGCAGG + Intergenic
915129999 1:153689369-153689391 GTAAAGCAGAACCAGAAGGCAGG - Intronic
916158566 1:161884775-161884797 CAAAATCAGAGTAAGAAGGCAGG + Intronic
916312530 1:163412810-163412832 TAAAATCAAGATCAGAGGCCAGG + Intergenic
916646671 1:166793446-166793468 AAAATTCAGTAACAGAAGGCAGG - Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
918605711 1:186423399-186423421 AAAAATCAGGAACACAAGGGTGG + Intergenic
918879698 1:190101080-190101102 GAAAGTCAAGATCAAAAGACTGG - Intronic
919678197 1:200408444-200408466 GAAAATAAGGAACAGAAGACCGG - Exonic
920078135 1:203351905-203351927 GAAAGACAAGATCAGAAAGCTGG + Intergenic
920432892 1:205929955-205929977 CGAAATCAGGATCTGCAGGCCGG + Exonic
922057188 1:222052530-222052552 GAAACTGAGCATCAGACGGCAGG - Intergenic
923799875 1:237198057-237198079 GAAGATTAGGATCAGATGGGGGG + Intronic
924156015 1:241177377-241177399 GAAAATAAGGAACAGGAGCCTGG + Intronic
1063235601 10:4112325-4112347 GAAAATGAGGATAAGAAGGGGGG + Intergenic
1065103371 10:22354187-22354209 TTAAATCAGGATCAGGAGACTGG + Intronic
1065904466 10:30237865-30237887 GGAAGTCAGGGTCAGAAGGAAGG + Intergenic
1066611086 10:37249134-37249156 GAATATCCGGCTCAGAAGCCAGG - Intronic
1067221177 10:44345467-44345489 GGCAGTCAGGAGCAGAAGGCAGG + Intergenic
1068912891 10:62397512-62397534 GAAGATCAGGATCAGGGGGATGG + Intronic
1071514245 10:86286702-86286724 GAAAGTGAGGTGCAGAAGGCAGG - Intronic
1072485456 10:95850189-95850211 CAAACTGAGGTTCAGAAGGCTGG - Intronic
1074169329 10:110918381-110918403 AAAAATCAGAATGGGAAGGCAGG + Intronic
1075549994 10:123385302-123385324 GAAAACAAGGACCAGAAGGGTGG - Intergenic
1076362808 10:129901392-129901414 GCTAATCAGGATCAGAATTCTGG - Intronic
1077511469 11:2966531-2966553 GAAAATCAGGCACAGAAAGGGGG - Intronic
1078855660 11:15204751-15204773 GTAAATCAGGCGGAGAAGGCTGG - Intronic
1079477525 11:20846950-20846972 GAAAAACAGGATCATAATCCTGG + Intronic
1080486827 11:32717149-32717171 TAACATCAGAATCAGAAGTCAGG - Intronic
1082825266 11:57573049-57573071 AAAAATGAGGGTGAGAAGGCCGG + Intergenic
1084853969 11:71968420-71968442 GAAAATCAGGAACAGCAAGATGG - Intronic
1087301108 11:96436954-96436976 GAAAATGAGGATGGAAAGGCAGG + Intronic
1087700289 11:101429603-101429625 AAAAACCAGGAGCAGAAGGTAGG - Intergenic
1090413359 11:126523971-126523993 GAAAATCAGACTCAGAAGCATGG + Intronic
1090580478 11:128153545-128153567 GGAAATCAGAATCAGAAGGTTGG + Intergenic
1092720236 12:11433848-11433870 GAAAGTCTGGAGCAGAAGCCAGG - Intronic
1093149149 12:15601447-15601469 GAAGAATAGGTTCAGAAGGCAGG - Intergenic
1093817452 12:23567262-23567284 TAAAGTCAGGATCAGATGGGAGG + Intronic
1094130003 12:27064505-27064527 GAACATCATGAACAGAAGGAAGG - Intronic
1097796756 12:63870876-63870898 GAAAATCAAGCTAGGAAGGCGGG - Intronic
1098753440 12:74325478-74325500 GAAAATGAGAATTAGAAGACTGG + Intergenic
1098897260 12:76078112-76078134 GCAAAACAGGAGCAGAAGGAAGG + Intronic
1099922246 12:88973184-88973206 GGAAAAGAGAATCAGAAGGCAGG + Intergenic
1099930457 12:89068294-89068316 GAAAATTAGGATAAGAAGAAAGG + Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101905454 12:108821641-108821663 GAGAACTAGGATCAGAAGACAGG + Intronic
1104683728 12:130770686-130770708 GAAAATCAAGATCAGGATGCTGG - Intergenic
1104879762 12:132062401-132062423 GAGAATGAGGATCTGAAGGTGGG + Intronic
1105202715 13:18193928-18193950 GAAAAACAGGATCAGAAGACAGG - Intergenic
1107278499 13:38705457-38705479 GATAAGCAAGATCAAAAGGCTGG - Intronic
1107681185 13:42852958-42852980 GAAAATCAGGATTATATAGCAGG + Intergenic
1108128616 13:47272577-47272599 GGAAATCAGGATAAGAAAGCCGG - Intergenic
1108981269 13:56518288-56518310 GAAAGTCAAGAAAAGAAGGCAGG + Intergenic
1109206063 13:59484058-59484080 TAAAATCAGGATTTGAAGCCAGG + Intergenic
1109741302 13:66559502-66559524 AAAAATACGGATCAGGAGGCCGG + Intronic
1111828325 13:93296497-93296519 GAACATCAGGTACAGGAGGCAGG - Intronic
1111953845 13:94734264-94734286 TAAAATCAGGAATAGAAGGGAGG - Intergenic
1112098849 13:96165396-96165418 GAAAAGCAATAACAGAAGGCAGG + Intronic
1112606826 13:100914519-100914541 GAAAGTCAGGATGATAAGGGTGG + Intergenic
1113291928 13:108916758-108916780 TAACATCAAGAACAGAAGGCAGG - Intronic
1113312914 13:109149714-109149736 GAAAAAGAGGAGGAGAAGGCAGG - Intronic
1114453975 14:22843762-22843784 GTTTATCAGGAACAGAAGGCCGG - Exonic
1114888010 14:26879617-26879639 GTAACTCAGGATTAGAAGGTAGG - Intergenic
1115539574 14:34407352-34407374 AAAAATCAGGATGAAATGGCAGG + Intronic
1116435320 14:44889285-44889307 GAAAATCATTCTCAGAAAGCAGG - Intergenic
1116824877 14:49663165-49663187 GAAAATGAGAATTAGAAGACTGG - Intronic
1121233758 14:92377533-92377555 GAACAGCAGGAACAGGAGGCAGG + Intronic
1122338030 14:101006633-101006655 TACAATGAGGATCAGAAGCCTGG - Intergenic
1124909751 15:33907461-33907483 AAAAATATGGAACAGAAGGCTGG - Intronic
1126106479 15:45150311-45150333 GCAGAGCAGGCTCAGAAGGCAGG + Intronic
1128033840 15:64505805-64505827 GAAATTCAAGTTTAGAAGGCTGG - Intronic
1129618841 15:77124191-77124213 GAAAATCTGTAGCAAAAGGCAGG - Intronic
1129706842 15:77799265-77799287 GACCATCATGATCAGAGGGCGGG + Intronic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130523479 15:84683203-84683225 GAAAGTCAGGAACAGCAGGAAGG + Intronic
1130727756 15:86458105-86458127 GATAACAAGGCTCAGAAGGCTGG + Intronic
1133528189 16:6626989-6627011 GAAACTGAGGCACAGAAGGCTGG + Intronic
1135924046 16:26676637-26676659 CAAAATCAGGATTTGAAGGCAGG + Intergenic
1137321027 16:47382630-47382652 TGAAATCATGATCAGAAGTCGGG + Intronic
1137798373 16:51240472-51240494 GAAAACCAGGATTCGAATGCGGG - Intergenic
1140685814 16:77433520-77433542 TTATATCAGGATCAGATGGCTGG - Intronic
1141105857 16:81233067-81233089 GAAAAGCAGGAAGATAAGGCAGG - Intergenic
1141391187 16:83665778-83665800 GGAAATAATGATCAGAAGGCTGG - Intronic
1142310719 16:89311869-89311891 GAAAATCAGGAACACAGGGAAGG + Intronic
1142364534 16:89643116-89643138 GAAAACCAGGATCTGGAGGCTGG - Intergenic
1142689089 17:1594119-1594141 GAAATTCAGAAGCAGGAGGCCGG - Intronic
1143974830 17:10821989-10822011 GAGAGTCAGGATTAAAAGGCTGG + Intergenic
1143976736 17:10835886-10835908 AAAAATCAGGATTTGGAGGCTGG - Intronic
1144265079 17:13561324-13561346 GAAAATCAGGAGCAGAGGGAAGG - Intronic
1144581156 17:16460350-16460372 GAAAGGGAAGATCAGAAGGCAGG + Intronic
1147131198 17:38410316-38410338 GAAAAACAGCATTGGAAGGCAGG - Intergenic
1148953797 17:51336905-51336927 CAAGTTCAGCATCAGAAGGCAGG + Intergenic
1150436004 17:65154738-65154760 CAAAATCAAGATCAGAAAACAGG - Intronic
1150661890 17:67088334-67088356 GGAAATCAGGAACTGGAGGCTGG + Intronic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153160596 18:2200399-2200421 GAAGAAGAGGATTAGAAGGCTGG + Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155838768 18:30621870-30621892 GAGAATCAGTCTCAGAAGGATGG - Intergenic
1155863615 18:30935793-30935815 GGAACTCAGGATCAGAGGTCTGG - Intergenic
1157013769 18:43683585-43683607 GGAAAACAGGATCTGCAGGCAGG - Intergenic
1158369032 18:56776834-56776856 GTAAAGCAGGAGCAGAAGGAGGG - Exonic
1158943358 18:62426626-62426648 GAAAATGAGAATCAGGAGGATGG - Intergenic
1160689741 19:456057-456079 GAAAAGCAGGACCAGAACCCGGG - Intronic
1160917894 19:1506480-1506502 GCAAATTAGGATCAGAAGAAGGG + Intronic
1163383711 19:16986116-16986138 GCAAAACAGGTTCAGAAGGATGG + Intronic
1163743415 19:19030835-19030857 GAAACTAAGGATCAGAGGACTGG + Intronic
1167097369 19:47381478-47381500 GAAGATCAGGAGCCCAAGGCAGG + Intronic
1168549307 19:57280165-57280187 GAAAATCGAGGTCAGGAGGCGGG - Intronic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925098519 2:1226664-1226686 GAAAATTAAGATAAGAAGCCTGG - Intronic
925106644 2:1297753-1297775 GAAAAGAAGGTCCAGAAGGCAGG + Intronic
926417124 2:12660711-12660733 GGAAATCAGAATGAGAAGGCAGG + Intergenic
926443246 2:12912071-12912093 GAAAATCAGGATAAGAAAGAAGG + Intergenic
928277937 2:29920000-29920022 GAAGATCTGGAAGAGAAGGCGGG + Exonic
929683422 2:44013768-44013790 TAAAATCATGAACACAAGGCTGG - Intergenic
931711702 2:64993451-64993473 GAGAATTGGGATGAGAAGGCTGG + Intronic
932550635 2:72765860-72765882 GAAAGTCAAGACCAAAAGGCAGG + Intronic
933104049 2:78299284-78299306 GAATATCTGGATCAGATGGTAGG + Intergenic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
933327917 2:80862682-80862704 AATAATCAGGACCAGAATGCTGG - Intergenic
933483579 2:82889112-82889134 AAAAATGAGGATTAGAAGGTTGG - Intergenic
934592742 2:95571025-95571047 GAAACTCAATACCAGAAGGCAGG - Intergenic
935593593 2:104863119-104863141 GAAGAACAGGATCAGAGGGTAGG - Intergenic
936904189 2:117517829-117517851 GAAAATCAGGCACAGAACACAGG + Intergenic
938143974 2:128819120-128819142 GAAAATAAGGGTAAGAAGGCTGG - Intergenic
939303860 2:140384064-140384086 GAAAAGCAGGAGAAGAAGGAAGG - Intronic
940419189 2:153458529-153458551 GAAAATCTGGCTAGGAAGGCTGG - Intergenic
940717695 2:157246354-157246376 GAGAGTCAGGATCAGAGGACAGG + Intergenic
941277950 2:163514391-163514413 GAACATAAAGCTCAGAAGGCCGG + Intergenic
943889074 2:193262624-193262646 GAAAATGAGGATAAGAGGGGTGG + Intergenic
945507021 2:210654132-210654154 GAAAAAAATGATGAGAAGGCAGG - Intronic
946085100 2:217162915-217162937 CAAGATGAGGATCAGCAGGCAGG - Intergenic
946382966 2:219361499-219361521 GAGAATCAGGAGCAGAATCCAGG + Intergenic
947337166 2:229099410-229099432 GAAACTCAGTACCAGAAGGCAGG + Intronic
948082110 2:235214850-235214872 GAAAAACAGGATCAGAAGCCTGG - Intergenic
1169004687 20:2196799-2196821 GAAACTGAGGATCAGAGGGATGG + Intergenic
1169502929 20:6178403-6178425 GAAAAACAGTCTCAAAAGGCAGG + Intergenic
1170823518 20:19774021-19774043 GAAGCTCAGGGTCAGAATGCAGG - Intergenic
1171031018 20:21676509-21676531 GAAAACCCAGTTCAGAAGGCAGG + Intergenic
1173291285 20:41717403-41717425 GAATCTCAGGAACAGAAGGCTGG + Intergenic
1173671230 20:44800424-44800446 GGACATGAGGATCAGAAGACAGG + Intronic
1173897534 20:46562320-46562342 GAAATTCAGGGCCAGGAGGCTGG - Intronic
1176715238 21:10344077-10344099 GAAAAACAGGATCAGAAGACAGG + Intergenic
1177500429 21:21947833-21947855 GAACTTGAGTATCAGAAGGCTGG - Intergenic
1177803447 21:25850451-25850473 GAAAGTCATGATCCCAAGGCAGG - Intergenic
1178409903 21:32354454-32354476 CAAAGTCAGGATTAGAACGCAGG - Intronic
1178570719 21:33733842-33733864 GAAAATAAGGATCATAACGCAGG - Intronic
1178825055 21:36008117-36008139 GAAAATGAGAATCAGATGGAGGG - Intergenic
1178843214 21:36155328-36155350 CAAAATCAGAATCAGCAGCCTGG + Intergenic
1179157734 21:38864497-38864519 GTAAATCAGATTCAGAAAGCTGG + Intergenic
1180603111 22:17035878-17035900 GAAAAACAGGATCAGAAGACAGG - Intergenic
1180897275 22:19345841-19345863 GAAAATGAGAAGCAGAAGGTTGG - Intronic
1181784838 22:25219536-25219558 GAAAAGCAGGGTGAGAATGCTGG - Exonic
1181944116 22:26502252-26502274 AATAATGAGGTTCAGAAGGCAGG + Intronic
1182158912 22:28102234-28102256 TAACATCAGTAACAGAAGGCAGG - Intronic
1182262658 22:29086139-29086161 GAAAATCAGGTCCAAAAGTCTGG - Intronic
1183926453 22:41209834-41209856 GAAAATGAGGATCGGGAAGCAGG + Exonic
1185123032 22:48984804-48984826 GAGACTCAGGATGGGAAGGCGGG - Intergenic
951024319 3:17813910-17813932 GGAAATCATGACCAGAAGGTGGG + Intronic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952891472 3:38044778-38044800 GAAAATATGGATCAGAAGTTTGG + Intronic
953969535 3:47336329-47336351 GAAAATCAGAATCAGACAGGAGG - Intronic
954350812 3:50042260-50042282 GATAAACAGTATCAAAAGGCAGG - Intronic
954477579 3:50762613-50762635 TAAGATCAGGATCAGAAAGTAGG - Intronic
954524834 3:51261101-51261123 TTAAATTAGGATCAGAGGGCTGG + Intronic
955235936 3:57139073-57139095 GAAATGCAGGATTAAAAGGCAGG + Intronic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
957158690 3:76580087-76580109 CTAAATCAGGAGCAGAGGGCAGG - Intronic
958168790 3:89912832-89912854 GACAATCAGGATCCGAAAGCTGG + Intergenic
959430205 3:106245081-106245103 GAAAATCATGGTCAAATGGCTGG - Intergenic
959526298 3:107381245-107381267 GAAAAACAGGAGCAGAGGGCGGG + Intergenic
961158150 3:124698270-124698292 GAAAAACAAGAGCAGGAGGCCGG - Intronic
961241641 3:125416655-125416677 GAAAATCTGGCTCACAAGGCAGG - Intergenic
961908183 3:130284521-130284543 GAAAATAAGGATCAGAGGGCTGG + Intergenic
962069859 3:132022134-132022156 GACATGTAGGATCAGAAGGCAGG + Intronic
962754370 3:138456944-138456966 GAATGCCAGGATCAGGAGGCAGG - Intronic
963622601 3:147631029-147631051 GAAAAGGAGAAGCAGAAGGCAGG - Intergenic
963634453 3:147776860-147776882 GAAAATGAGGATCATAAAGTAGG - Intergenic
965738596 3:171849041-171849063 GAAAATCAGGATTGAAAGCCAGG - Intronic
965803940 3:172523319-172523341 GAAGATCACGATCAGCACGCAGG + Exonic
967178118 3:186879216-186879238 GAAAATCAGTATCATAAAGGAGG - Intergenic
967364490 3:188670419-188670441 GAAAATCAGCATAAGAACCCAGG + Intronic
967848158 3:194060675-194060697 GAAAGTCAGGATAAGAGGTCAGG + Intergenic
968754269 4:2407148-2407170 GAAAATCAAAGTCAGAAGGAAGG - Intronic
969621476 4:8280984-8281006 GAGAACCAGGATCTGAACGCAGG - Intronic
971787282 4:31120722-31120744 GAATGTCAGGATTAGAAAGCAGG + Intronic
974520085 4:62972176-62972198 GAAAATCATGGTCAGAACACAGG - Intergenic
974593374 4:63984307-63984329 AAAAATCAGGATCAAAAATCAGG - Intergenic
975208221 4:71668559-71668581 GAAATGCAGAATCATAAGGCTGG - Intergenic
977105608 4:92880094-92880116 GGAAATCAGGATCTCAAGTCAGG + Intronic
977290831 4:95162616-95162638 GAAAATCAGGATTGGCAGCCAGG + Exonic
977954624 4:103012386-103012408 GTTAATCATGATCAGAAGGCTGG - Intronic
978109682 4:104947564-104947586 GAAAAACAAGATCAGAGGGCGGG - Intergenic
978932512 4:114332312-114332334 GAATCTCAGGCTCAGAGGGCTGG + Intergenic
980528686 4:134022139-134022161 GAAATTCAGGATAAGGAAGCCGG - Intergenic
980623776 4:135344980-135345002 CAACAGCAGTATCAGAAGGCCGG - Intergenic
980692937 4:136319783-136319805 GAAACTCAAGATCCGATGGCTGG - Intergenic
983061614 4:163166994-163167016 GAAAATCAGGATTAGGGGGTCGG + Intergenic
984663994 4:182405821-182405843 TAAACTCAGGGACAGAAGGCAGG + Intronic
985870221 5:2548558-2548580 GAACATCAGGAAAAGAAGCCAGG - Intergenic
987118121 5:14742483-14742505 GAAAATCAGGATTCAATGGCAGG - Intronic
987572157 5:19677727-19677749 GCAAATGAGAAACAGAAGGCAGG + Intronic
988820063 5:34874369-34874391 TCAAATTAGGAGCAGAAGGCAGG + Intronic
990363852 5:55049186-55049208 GAAAATAAAGATAATAAGGCTGG + Intergenic
990481268 5:56213746-56213768 GAACACCAGGACCAGAGGGCAGG + Intronic
990802908 5:59625460-59625482 GAAATTCAGGATAACAGGGCTGG - Intronic
995130609 5:108626560-108626582 AAAAATCAGGCTCAGAATGCTGG + Intergenic
995496655 5:112752174-112752196 GAAAATATGAATAAGAAGGCAGG - Intronic
995946185 5:117649200-117649222 GAAATTCTGGTTCAAAAGGCAGG - Intergenic
996484505 5:124015925-124015947 GAAAGTCAGGTTCAGATGACTGG + Intergenic
997465594 5:134085894-134085916 GAAAAACAGAATAAAAAGGCTGG + Intergenic
997672620 5:135688689-135688711 GAAAAGCAGGCCCTGAAGGCTGG + Intergenic
999397409 5:151238714-151238736 GAACATCTGGACCAGAAGGCAGG + Intronic
999483506 5:151970638-151970660 AAAAATCAGTATCTGTAGGCCGG - Intergenic
999624338 5:153504598-153504620 GTAAGTCAAGATCAGAAGTCAGG + Intronic
999655306 5:153805045-153805067 GAAAATGAGGATCAGAGGCCTGG - Intronic
1001180278 5:169513806-169513828 GAAAAACAGGATCATTAGGTGGG - Intergenic
1001215793 5:169854611-169854633 GAAAGTCAGGGGCAGAAGTCAGG + Intronic
1003052191 6:2790170-2790192 TAACATCAGTATCAAAAGGCCGG - Intergenic
1003455837 6:6281409-6281431 AATAATCAGGATCCGATGGCTGG - Intronic
1003516859 6:6825146-6825168 GAAAATCAGGATGTGGTGGCAGG + Intergenic
1005000990 6:21241530-21241552 GAAAATCAAAACCAGAAAGCTGG - Intergenic
1005238963 6:23801137-23801159 GAAAAACATGTTCAGAAGCCAGG + Intergenic
1005469317 6:26146166-26146188 AAAAATTTGTATCAGAAGGCCGG - Intergenic
1006109849 6:31737902-31737924 GAAATTCAGGATATGGAGGCTGG - Intronic
1006840100 6:37022988-37023010 GAAAATGATGATAAGAATGCAGG - Intronic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007521804 6:42455696-42455718 TACAATCAGGGTCAGAAGGAGGG + Intergenic
1011162508 6:84407385-84407407 GAAATCCAGTATCAGAAGGTAGG + Intergenic
1011466666 6:87665057-87665079 GGAATTCAGGATCAGAGGGCAGG - Intronic
1012674269 6:102095214-102095236 AAAAATCAAGAAAAGAAGGCTGG - Intergenic
1014029561 6:116684727-116684749 GAAAATACGGATCAGAACTCAGG - Intronic
1014166455 6:118230685-118230707 CAAAATCAAGATGATAAGGCTGG + Intronic
1015619751 6:135118609-135118631 GAAAATAAGGATCACAAGAGTGG - Intergenic
1015977969 6:138810644-138810666 GAAATGCAGTTTCAGAAGGCTGG - Intronic
1016376884 6:143430347-143430369 GACCATCTGAATCAGAAGGCAGG - Intronic
1018435155 6:163752604-163752626 CTAAATCAGAATCAGAAGACGGG + Intergenic
1021336415 7:19408139-19408161 GGAAATCAGGAGCAGAAAGCAGG - Intergenic
1022849495 7:34245849-34245871 GAAAATGAGGAACAAGAGGCTGG + Intergenic
1023972962 7:45005152-45005174 GTAACTCAGGGTCAGGAGGCTGG + Intronic
1024045994 7:45586075-45586097 GAAAGTGAGGAACACAAGGCAGG - Intronic
1024539288 7:50463062-50463084 TAAAATAAGGAAGAGAAGGCCGG - Intronic
1024896336 7:54266064-54266086 GAAAATGAGGATAAGAAGTCAGG + Intergenic
1027747737 7:82098816-82098838 AAACATCATCATCAGAAGGCAGG + Intronic
1027880208 7:83825407-83825429 AAAATTCAGGAACAGAAGGGAGG - Intergenic
1029088666 7:98031511-98031533 GAAACTGAGGCTGAGAAGGCAGG - Intergenic
1032469456 7:132167842-132167864 GAAAAGCAGAATCACAAGCCAGG - Intronic
1032633742 7:133683045-133683067 GAAAATCAAGGTGAGAAGGGAGG - Intronic
1037126715 8:15360681-15360703 GAAAATCAAGACCAAGAGGCAGG + Intergenic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1038039897 8:23715654-23715676 GAAAAACAAGTTCAGAAGCCTGG - Intergenic
1039177243 8:34823731-34823753 GAAAATCAGAGTCAAAAGACAGG + Intergenic
1041084619 8:54245223-54245245 GAGAATCAGGATGGGAAGGAGGG + Intergenic
1043045782 8:75322822-75322844 AAAAGTCAAGATCTGAAGGCTGG - Intergenic
1044309368 8:90675971-90675993 GAAAATCAGGATAAGAAATTTGG + Intronic
1045345292 8:101288402-101288424 GAAAGGCTGAATCAGAAGGCAGG + Intergenic
1045421381 8:102019391-102019413 GAATTTCTGGATCATAAGGCAGG - Intronic
1045503864 8:102764500-102764522 AAAAATCAGGATAAGAAGCATGG - Intergenic
1045587833 8:103559254-103559276 GAAAATCAGGATCAGAAGGCTGG - Intronic
1048342064 8:133547866-133547888 GATAATGAGGGCCAGAAGGCAGG + Intronic
1048599417 8:135903584-135903606 GAATAACAGGATTGGAAGGCAGG - Intergenic
1049320079 8:141991629-141991651 GAAGACCATGATCAGGAGGCCGG - Intergenic
1050574733 9:6982190-6982212 GAAAATAAGCATCATAAGTCTGG - Intronic
1050758773 9:9040233-9040255 CAAAATCAGGATTTGAAAGCAGG + Intronic
1050996547 9:12227001-12227023 GAAAATCAGGGGGAGAATGCAGG + Intergenic
1052636201 9:31108162-31108184 GAAAAACTGGATCAGAAGAAGGG - Intergenic
1053072575 9:35110021-35110043 GAAAATCAGGAACAGAGGTGGGG + Exonic
1054754272 9:68941400-68941422 CAACATCAGAAGCAGAAGGCAGG + Intronic
1056301282 9:85244417-85244439 GGAAAACAGGACTAGAAGGCAGG + Intergenic
1056828273 9:89891601-89891623 GAATATCACGATCAAATGGCTGG - Intergenic
1058260541 9:102824385-102824407 GAAAATATGGATCAAAAGGGAGG + Intergenic
1058389974 9:104485084-104485106 GATAATCAGAGTCAGAAAGCTGG + Intergenic
1059754667 9:117281626-117281648 GAAAATGTGGAACAGGAGGCTGG + Intronic
1059821839 9:117982341-117982363 GAAAAGGAGCATCAGAAGGATGG - Intergenic
1059870824 9:118573041-118573063 GAAAATAAGGATCAGAAAGAAGG - Intergenic
1061023917 9:128035137-128035159 AAAGCTCAGGAACAGAAGGCAGG - Intergenic
1061620607 9:131809081-131809103 GAAAATCAGGCTCAGAGAGGTGG - Intergenic
1061946373 9:133910512-133910534 GAAAATCAGGGACAGAAGGCTGG + Intronic
1062281871 9:135755576-135755598 CAAACTCAGGCTCAGTAGGCAGG + Intronic
1187655245 X:21464117-21464139 GAAACTCAAGTTCAGATGGCTGG + Intronic
1187856728 X:23644152-23644174 GAAATTCAGGAAGACAAGGCAGG - Intergenic
1189737460 X:44086350-44086372 GAAACTCATGATCAAAAGCCAGG + Intergenic
1189898786 X:45684209-45684231 GAAAATCAGAATCACAGGGATGG + Intergenic
1190728555 X:53208925-53208947 GCTACTCAGGATCAGGAGGCAGG - Intronic
1193397746 X:81005149-81005171 TAAAACCAGGTTCAGAAAGCTGG + Intergenic
1193418465 X:81253939-81253961 GAAATTGAGGATCAGGAAGCAGG + Intronic
1196164162 X:112520059-112520081 TAAATTCAGGATCTGAAGGTTGG + Intergenic
1196498963 X:116355416-116355438 GAAAATGAGTTTCAGAAGGAAGG - Intergenic
1196510201 X:116500130-116500152 GAAACTCAAGTTCAGAGGGCTGG + Intergenic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1197690261 X:129492649-129492671 GAAAATCAGGATGACAATCCAGG + Intronic
1199564781 X:149204119-149204141 GAAAGACAGGACCAGAAGACAGG + Intergenic
1199770053 X:150969502-150969524 GAAAATGCGGACCAGAAGTCGGG + Intergenic
1201385671 Y:13437184-13437206 GAAAAACAGGATGAAGAGGCAGG + Intronic