ID: 1045592599

View in Genome Browser
Species Human (GRCh38)
Location 8:103614341-103614363
Sequence AGGGAGAGCATAGTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 20, 2: 40, 3: 112, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045592599_1045592607 8 Left 1045592599 8:103614341-103614363 CCCCCAGTCACTATGCTCTCCCT 0: 1
1: 20
2: 40
3: 112
4: 370
Right 1045592607 8:103614372-103614394 TGCACAGACTCTGTGCTGCATGG No data
1045592599_1045592608 26 Left 1045592599 8:103614341-103614363 CCCCCAGTCACTATGCTCTCCCT 0: 1
1: 20
2: 40
3: 112
4: 370
Right 1045592608 8:103614390-103614412 CATGGCCTTTGCTAGTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045592599 Original CRISPR AGGGAGAGCATAGTGACTGG GGG (reversed) Intronic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
901102052 1:6726476-6726498 AGGAAGAGCATTGTAGCTGGAGG - Intergenic
901660408 1:10795245-10795267 AAGGAGAGCGTGGTGACTGACGG - Intronic
902172857 1:14627136-14627158 AGGGAAATCAGAGTGGCTGGGGG + Intronic
902383657 1:16064465-16064487 AGGGAGAGCAGAGCCTCTGGGGG - Intronic
902808155 1:18873501-18873523 AGGGAGGGCAGAGGGGCTGGAGG + Intronic
903499206 1:23792368-23792390 AGGCAGGGCATAGGGACTGTAGG - Intronic
904556273 1:31366855-31366877 AGGGACAGGCTCGTGACTGGTGG - Intronic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905930591 1:41784119-41784141 AGGGAGAGCAGGGTTCCTGGGGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
908751504 1:67429234-67429256 AGAGAGAGGATCGTGACTCGAGG + Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909779952 1:79531845-79531867 AGGGAGAGCCTGGAGACTTGGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910209753 1:84780768-84780790 AGGCAAAGTATGGTGACTGGAGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911275545 1:95853729-95853751 AGGGAGAGCCTAAAGCCTGGGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
913995129 1:143645406-143645428 AGGGAAAGAATCTTGACTGGTGG + Intergenic
915078788 1:153336992-153337014 AGGGTGAGCATTATGTCTGGGGG + Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917500149 1:175578369-175578391 AGGGAGAGGAAAGGCACTGGAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919122293 1:193356347-193356369 AGCCAGAACATAGTGACTGGTGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920606167 1:207389012-207389034 AGGTAGAGAGTAGTCACTGGAGG + Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921449851 1:215292324-215292346 AGTGAGAGGATAGTGACAGGTGG - Intergenic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922867816 1:228875444-228875466 AGTGAGAGTATTGTGAGTGGAGG + Intergenic
922876366 1:228942885-228942907 AGGGATAGAATTGTTACTGGGGG - Intergenic
923638513 1:235725652-235725674 AGGGAAAGCAGAGTCTCTGGAGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064261370 10:13788928-13788950 AGGGAGAGCAGGGAGAATGGAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065083582 10:22151587-22151609 AGTGAGAGCGTAGTGAGTGCCGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066248555 10:33609887-33609909 AGAGAGAGCATACAGTCTGGGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070733814 10:78849986-78850008 AGGGAGAGCATTCTGAGAGGAGG - Intergenic
1071893370 10:90037462-90037484 AGGGGCAGCATAGGGACTAGCGG + Intergenic
1071913055 10:90257570-90257592 AGGGAGGGCTTAAGGACTGGGGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1073486081 10:103819974-103819996 AGGGAGACCCTAGTTCCTGGAGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075302385 10:121336658-121336680 AGGGAGACAATAGGGAGTGGTGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078172306 11:8937634-8937656 AGGGTCAGCATGGTGGCTGGTGG + Exonic
1078634483 11:13036207-13036229 AGGGAGATCATATTAACTTGTGG + Intergenic
1078855027 11:15200352-15200374 AGGAATAGCATGGTGACTGTTGG + Intronic
1079069373 11:17329590-17329612 GGAGGGAGCATAGCGACTGGGGG - Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081718303 11:45267345-45267367 AGGGGCAGCATAGTGGGTGGTGG - Intronic
1083169329 11:60913587-60913609 AGGCAGTGCATAGGGACAGGAGG - Intergenic
1083477445 11:62923359-62923381 AGGGAGACCAAGGAGACTGGGGG - Intergenic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1084308034 11:68299260-68299282 AGGGACAGCTTGGGGACTGGAGG + Intergenic
1084747783 11:71184160-71184182 AAAAAGAGCATAGTGACAGGTGG - Intronic
1085052108 11:73385176-73385198 TGGGAGAGCTTAGGGACTGTAGG + Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086069297 11:82782188-82782210 AGGCAGAGAATAGGGTCTGGAGG + Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086928179 11:92663422-92663444 AGGGAGAGTATAGTTGCTGATGG + Intronic
1087811204 11:102610965-102610987 AGGGAAAGCAGTGTGACTCGGGG - Intronic
1088177589 11:107071868-107071890 AGGGTGTGTATAGTGACTGTTGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089456893 11:118631100-118631122 AGGGAGAGCAGGGTTACAGGGGG - Intronic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096480068 12:51934224-51934246 AGGGAGTCCAGAGTGGCTGGAGG - Intergenic
1096973098 12:55683049-55683071 AGGGAGAGTATAGTGAGGCGAGG + Intronic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099636693 12:85222656-85222678 AGAGAGAGAAGAGTCACTGGAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1104057107 12:125239036-125239058 AGGGAGAGCATGGTGAGGGGCGG + Intronic
1104310327 12:127649005-127649027 AGGAAGAGCCTGGTGCCTGGAGG - Intergenic
1104720728 12:131043774-131043796 CCGGAGGGCATAGTGACTGGAGG + Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1108132457 13:47317470-47317492 AGGGAGAGGATCATGACTGAGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110292483 13:73823476-73823498 ACGGAGAGCATACTAATTGGAGG - Intronic
1110584127 13:77168473-77168495 TATGACAGCATAGTGACTGGAGG + Exonic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114430859 14:22659164-22659186 AGGGAGAGCAGAGATGCTGGAGG - Intergenic
1114703470 14:24702815-24702837 AGGCAGAGAATGGTGATTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117218211 14:53574053-53574075 AGGGGGAGAATAGAGGCTGGGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117545097 14:56787093-56787115 AGGGAGAACATAATGATGGGTGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118509348 14:66453939-66453961 AGAGAGAACAGGGTGACTGGAGG + Intergenic
1118672412 14:68143702-68143724 AGGCAGAGTATAGTGACAGCTGG - Intronic
1120106202 14:80498284-80498306 AGGGAGACAATGGTGACTTGGGG - Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121544955 14:94756371-94756393 AGAAAGAGCAGAGTGTCTGGTGG + Intergenic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1125193421 15:37019662-37019684 AGGGAGAGCATAGTGTGGGGAGG + Intronic
1127525935 15:59792115-59792137 AGGGAGGGCCTAATGGCTGGGGG - Intergenic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1131616985 15:94026692-94026714 AATGGGAGCATTGTGACTGGTGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133169362 16:3971640-3971662 AGGAAGAGAATATGGACTGGGGG + Intronic
1133458678 16:5966866-5966888 GAGGACAGGATAGTGACTGGTGG - Intergenic
1133713068 16:8420095-8420117 AGAGAGAGAATAATGACTGGAGG + Intergenic
1136111713 16:28067638-28067660 AGGGACAGCATGGAGACAGGAGG - Intergenic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137023790 16:35454361-35454383 AGGCAGAGCAGTGTGAGTGGGGG - Intergenic
1137377862 16:47969536-47969558 ATGGAGAGCATTGTAAGTGGAGG - Intergenic
1137558820 16:49490063-49490085 TGTGAGAGCATTGAGACTGGTGG - Exonic
1138194987 16:55045385-55045407 ATGGAGAGCAGAGGGCCTGGAGG - Intergenic
1138376485 16:56567814-56567836 AGAGTGAGTATGGTGACTGGGGG + Exonic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140109405 16:71990289-71990311 AGGAAGAGGATAGTGACATGTGG + Exonic
1140234974 16:73150676-73150698 AGGGGTATCAGAGTGACTGGTGG + Intergenic
1140660099 16:77181083-77181105 AGGAGGAGCATGGTGACTTGGGG + Intergenic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1203141172 16_KI270728v1_random:1767797-1767819 AGGGAGAGCTGTGTTACTGGTGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144316769 17:14069448-14069470 AAGGAGAGCGTGGTGTCTGGAGG - Intergenic
1144858478 17:18284388-18284410 AGGAAGAGCAGAGGGGCTGGAGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146483235 17:33222104-33222126 AAAGGGAACATAGTGACTGGGGG + Intronic
1147898907 17:43770712-43770734 TGGTGGAGCATAGAGACTGGGGG + Intronic
1147907812 17:43833967-43833989 GGGGAGAGCATAGGAACTGCTGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150055002 17:62006561-62006583 AGGTAGAGCTTGTTGACTGGTGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151390336 17:73782815-73782837 AGGGAGAGCCTGGGGACTGAAGG - Intergenic
1153093396 18:1373594-1373616 AGGGATGGCATAGTGCCTAGAGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153856008 18:9147632-9147654 AGTGAGAGCAGTGTGACTAGAGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1158403666 18:57142640-57142662 TGGGAGAGCATGGTCACTGCTGG + Intergenic
1159088518 18:63820865-63820887 AGGGAGGGTTTAGTGAATGGAGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1162433852 19:10644859-10644881 CTGGGGAGCATAGTGACTGCAGG - Intergenic
1162744279 19:12790141-12790163 GGGGAGAGGATGGTGGCTGGAGG + Intronic
1163113974 19:15178329-15178351 AGGGTGAGGATGGTGATTGGGGG - Intronic
1163552413 19:17973016-17973038 TGGGAGACCATTGTGGCTGGAGG + Intronic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1165748385 19:38244844-38244866 AGTGACAGGATAGTGACTGAGGG + Intronic
1165991797 19:39819521-39819543 AGGGAGAGCATGGTGAGCTGAGG - Intergenic
1166305029 19:41932616-41932638 GGGGAGAGCAGAGGGAATGGGGG + Intergenic
1167567113 19:50263451-50263473 AGGGAGAGGATAGGGCCTTGGGG + Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927743951 2:25598721-25598743 AGGTTGAGGATAGGGACTGGGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931151173 2:59575114-59575136 AGGGAGACTAGTGTGACTGGAGG + Intergenic
931411935 2:62041095-62041117 AGGAAGAGCAAAGTTTCTGGTGG - Intronic
932985360 2:76720135-76720157 AAGGAGAGAATAGTTACTGCAGG - Intergenic
935188749 2:100758562-100758584 GGCTAGAGCATAGTGACTGAGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
939727319 2:145738379-145738401 AGAGAGAGCATTGTAACAGGAGG + Intergenic
940018003 2:149126796-149126818 AAGGAGAGAATAGAGAATGGAGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942391893 2:175503362-175503384 AGGGACAGCATAGCAATTGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
946996531 2:225398649-225398671 AGGGAGAGCATTGGGATAGGGGG + Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171979510 20:31617645-31617667 AAGGAAACCAAAGTGACTGGAGG - Intergenic
1172778443 20:37421713-37421735 AGGGAGACAAAAGTGAGTGGAGG - Intergenic
1173490543 20:43476524-43476546 TGGGACAGCATACTGTCTGGGGG - Intergenic
1175067057 20:56298036-56298058 GGAGAGAGCAGGGTGACTGGTGG + Intergenic
1175540046 20:59742757-59742779 AGGGAGAGCAGCGTGGGTGGAGG + Intronic
1175853605 20:62107069-62107091 AAGGAGACCAGAGTGGCTGGAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1179585336 21:42370803-42370825 AGGGAGTGGATGGTGTCTGGAGG - Intergenic
1179801105 21:43811842-43811864 AGTGAGAGGATTGTGCCTGGGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181594331 22:23904591-23904613 GGGGACAGCATAGTTACTGTGGG + Intergenic
1183034094 22:35127648-35127670 AGTGAGAGCTTAGTGCCTGTGGG - Intergenic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950543774 3:13627106-13627128 AGAGATGGCAGAGTGACTGGGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951319950 3:21232416-21232438 GGGGAGCCCATAGTGCCTGGTGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951822078 3:26825034-26825056 AGGGAATCGATAGTGACTGGAGG + Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
953933330 3:47018280-47018302 AGGGAGGACATAGTAAGTGGTGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956531688 3:70226879-70226901 AAGGAGAGAAGAGGGACTGGTGG + Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958111709 3:89156159-89156181 AGGAAGATTATAATGACTGGTGG + Intronic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961022292 3:123518373-123518395 AAGAAAAGCATGGTGACTGGAGG - Intronic
962262932 3:133926566-133926588 AGGCAGAGCGTGGTGAGTGGTGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965187772 3:165487490-165487512 AGGGAGGGGAGAGGGACTGGAGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968236326 3:197031964-197031986 AGGGAGAGCATACAGACTAAAGG + Intergenic
968663687 4:1809613-1809635 AGGGAGAGCAGAGGGGATGGGGG - Intergenic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968902040 4:3436459-3436481 AGGCTGAGCAAAGTGCCTGGGGG + Intronic
970028253 4:11647552-11647574 TGGAAGAGCTTAGGGACTGGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
971358446 4:25914961-25914983 AGGCTGAGAATGGTGACTGGGGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972551961 4:40142114-40142136 AGGGAGACCATAGGGAGAGGGGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973192493 4:47401518-47401540 AGAGAGAACCTAGGGACTGGTGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975696480 4:77019086-77019108 AGGGAGAAGATAGAGACTGGTGG + Intronic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984802749 4:183729755-183729777 AAGGAGAGCAGGGTGAGTGGGGG + Intergenic
984808031 4:183769337-183769359 GGGGAGAGCATCGTGGTTGGTGG + Intergenic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988020038 5:25609898-25609920 ATGGAGAGGATACTGACTTGGGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993940739 5:94055423-94055445 AGAGAGAGGCTAGTGACTGAAGG - Intronic
994310048 5:98259172-98259194 AGGGAGAGACTCGTGGCTGGTGG - Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998373095 5:141673518-141673540 AGGGGGATCATAGGGTCTGGGGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999085289 5:148883054-148883076 AGAGAGAGCAGGGTGAGTGGAGG - Intergenic
1000093290 5:157948909-157948931 AGGAAGAGCATTGTGCCTGCGGG - Intergenic
1000295408 5:159909181-159909203 ACGGGGAGCATAGTGAAGGGGGG - Intergenic
1000419409 5:161021238-161021260 AGGGAGAGGATAGTGATGAGTGG + Intergenic
1000958687 5:167572948-167572970 AGGGAGGGCATGGTGTCTGAAGG - Intronic
1001010950 5:168097856-168097878 AGGAAGAGAATAGGGAGTGGTGG - Intronic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002705892 5:181160712-181160734 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705901 5:181160742-181160764 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705910 5:181160772-181160794 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705919 5:181160802-181160824 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002705928 5:181160832-181160854 AGGACGAGCATCGTCACTGGGGG + Intergenic
1002706027 5:181161162-181161184 AGGACGAGCATCGTCACTGGGGG + Intergenic
1004168739 6:13279050-13279072 AGGGAAAGAATAGTGTCAGGGGG - Intronic
1004361405 6:14974351-14974373 AGTGAGAGGATAGGGCCTGGTGG + Intergenic
1006935853 6:37717122-37717144 AGGGAGATCATAGTGTCGGTTGG - Intergenic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007595447 6:43048310-43048332 GGTGAGAGCATGGTGACAGGTGG - Exonic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009931141 6:70178905-70178927 GGGGAGAGCATGCTGACCGGAGG - Intronic
1009935024 6:70223937-70223959 GGGGAGAGCAAAGTGAGAGGAGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1013693486 6:112672980-112673002 AGGGAGGGCATCGTGAGCGGGGG - Intergenic
1014538650 6:122648128-122648150 GGGGAGCCCAAAGTGACTGGTGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018792947 6:167163442-167163464 AGTGAGAAAATTGTGACTGGGGG + Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021836901 7:24686045-24686067 AGGGAGAGCATAATTTCTGGGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023789107 7:43737735-43737757 AGGGAGGGCCTAAAGACTGGGGG + Intergenic
1023799713 7:43823321-43823343 AGGCAGAGGATAGTGAAGGGAGG - Intergenic
1024345572 7:48310144-48310166 ATGGAGAGCATGCTGGCTGGGGG + Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025780223 7:64595094-64595116 AAGGTGAGCAACGTGACTGGGGG - Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028134488 7:87211225-87211247 AGGAAGAACAAAGTGCCTGGAGG - Intronic
1028179191 7:87697895-87697917 AGGGGAAGCAGGGTGACTGGTGG - Intronic
1028998659 7:97129738-97129760 GGGCAGAGCATAGAGACTAGTGG - Intronic
1030987882 7:116263479-116263501 AGGGAGAGAAGAGTGGCTGAAGG - Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031417366 7:121509826-121509848 GGGGAGAGCAGAGTGAGTTGGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034261552 7:149759877-149759899 AGTCAGAGCATAGTGAAGGGAGG - Intergenic
1034868094 7:154657814-154657836 AGGGAAAGGAAAGAGACTGGTGG + Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035600527 8:894602-894624 GGGGAGAGCAGAGTGACAGCTGG + Intergenic
1037164208 8:15807233-15807255 TGGAAGAGCATAATGCCTGGGGG - Intergenic
1037295519 8:17396439-17396461 AAGGAGAGCATAGCTACTTGAGG + Intronic
1037650017 8:20827822-20827844 AGGGAGACCATAAGGAGTGGTGG + Intergenic
1037810205 8:22082270-22082292 TGAGAGAGCATAGTGTGTGGGGG - Exonic
1039010682 8:33089726-33089748 AGGGTGAGCATAGGTATTGGAGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039511814 8:38097974-38097996 AGAGAGAGCAGAGGGACAGGAGG - Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1042385662 8:68170716-68170738 AGGGTGAGAATGGTGAATGGAGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046196092 8:110864242-110864264 AGGGAGAGGATAGTCAGTGGGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048411874 8:134183266-134183288 AGGGTGAGCAGAGTGAAAGGTGG + Intergenic
1048427787 8:134338768-134338790 AGGGAGAGAAGAGAGGCTGGAGG - Intergenic
1048592953 8:135838436-135838458 AGGGAGAGCAGAGACACTAGAGG - Intergenic
1048840122 8:138558152-138558174 GGGGAGAGCCAGGTGACTGGGGG + Intergenic
1048966540 8:139618895-139618917 ATGGAGAACATGGTGACTGTGGG - Exonic
1048982550 8:139710638-139710660 GGTGACAGCATAGTGACTGGTGG + Intergenic
1049172763 8:141172143-141172165 TGGGTGTGCATAGTGACTGTGGG + Intronic
1049292345 8:141811063-141811085 AGGGAGGGCAGAGGGGCTGGAGG + Intergenic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1049848425 8:144817213-144817235 AGGGAGTACATAATCACTGGGGG - Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052549348 9:29928313-29928335 AGAGAGAGCATAGAGACAGCAGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056177957 9:84053826-84053848 AGGGATAGCCTGGTGAGTGGAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056775728 9:89511192-89511214 AGAGAGAGCTAAGTGCCTGGAGG - Intergenic
1057765273 9:97911223-97911245 ATGAAAAGCATAGTCACTGGAGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058893132 9:109378427-109378449 ATGGAGACCATTGTGACTGGGGG + Exonic
1059111119 9:111559300-111559322 ATGGAGGGCATCGTGCCTGGGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060750793 9:126167108-126167130 AGGGAGAGGATGGTGAGCGGGGG + Intergenic
1060891642 9:127192994-127193016 AGTCAGAGCTGAGTGACTGGAGG + Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185552871 X:997957-997979 AGGGAGAGCTGTGTTACTGGCGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186939542 X:14490103-14490125 AAGGAGAGGATACTGACTGATGG - Intergenic
1187017165 X:15341250-15341272 AGAGAGAGCATCCTGAATGGGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974544 X:36657455-36657477 ACAGAGAGCAAAGAGACTGGAGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189683676 X:43542129-43542151 AGGGAAAGGATAGTGTCTGGCGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195996464 X:110736612-110736634 AAGGAGACCATGGTGTCTGGTGG + Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196788542 X:119443419-119443441 AGAGAGAGAATAGAGAATGGGGG - Intronic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200384741 X:155879382-155879404 AGGGTTACCATAGTGAATGGTGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic