ID: 1045597740

View in Genome Browser
Species Human (GRCh38)
Location 8:103675410-103675432
Sequence TAGGAGGCAAAACTGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045597732_1045597740 1 Left 1045597732 8:103675386-103675408 CCATGCAACCCTTTGCAGAATGG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG No data
1045597731_1045597740 7 Left 1045597731 8:103675380-103675402 CCTGTTCCATGCAACCCTTTGCA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG No data
1045597737_1045597740 -8 Left 1045597737 8:103675395-103675417 CCTTTGCAGAATGGCTAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG No data
1045597735_1045597740 -7 Left 1045597735 8:103675394-103675416 CCCTTTGCAGAATGGCTAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045597740 Original CRISPR TAGGAGGCAAAACTGGACCA GGG Intronic
No off target data available for this crispr