ID: 1045602387

View in Genome Browser
Species Human (GRCh38)
Location 8:103732708-103732730
Sequence GTCCGCGGTGGTGGTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045602387_1045602392 -3 Left 1045602387 8:103732708-103732730 CCTTCATCACCACCACCGCGGAC No data
Right 1045602392 8:103732728-103732750 GACCTATGGCCTCTACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045602387 Original CRISPR GTCCGCGGTGGTGGTGATGA AGG (reversed) Intronic