ID: 1045602502

View in Genome Browser
Species Human (GRCh38)
Location 8:103733498-103733520
Sequence CGCAGTCTGGTGGCCTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045602497_1045602502 -4 Left 1045602497 8:103733479-103733501 CCAGGACTTACCCAGAAATCGCA 0: 1
1: 0
2: 9
3: 67
4: 201
Right 1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG No data
1045602492_1045602502 29 Left 1045602492 8:103733446-103733468 CCCAAGTTCACTGACTTCAAGCC 0: 1
1: 0
2: 10
3: 69
4: 363
Right 1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG No data
1045602496_1045602502 7 Left 1045602496 8:103733468-103733490 CCAGCATAGCACCAGGACTTACC 0: 2
1: 14
2: 76
3: 194
4: 406
Right 1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG No data
1045602493_1045602502 28 Left 1045602493 8:103733447-103733469 CCAAGTTCACTGACTTCAAGCCC 0: 1
1: 0
2: 16
3: 88
4: 329
Right 1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG No data
1045602495_1045602502 8 Left 1045602495 8:103733467-103733489 CCCAGCATAGCACCAGGACTTAC 0: 2
1: 15
2: 80
3: 185
4: 367
Right 1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045602502 Original CRISPR CGCAGTCTGGTGGCCTAGAA TGG Intronic
No off target data available for this crispr