ID: 1045605422

View in Genome Browser
Species Human (GRCh38)
Location 8:103768355-103768377
Sequence CACTTTTTATGAGAAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 2, 2: 6, 3: 23, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045605419_1045605422 26 Left 1045605419 8:103768306-103768328 CCACTGGCTGCCAGAAACTCATT 0: 5
1: 7
2: 7
3: 12
4: 211
Right 1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG 0: 1
1: 2
2: 6
3: 23
4: 184
1045605421_1045605422 16 Left 1045605421 8:103768316-103768338 CCAGAAACTCATTGAAGTGGATG 0: 3
1: 5
2: 7
3: 14
4: 135
Right 1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG 0: 1
1: 2
2: 6
3: 23
4: 184
1045605418_1045605422 30 Left 1045605418 8:103768302-103768324 CCAGCCACTGGCTGCCAGAAACT 0: 6
1: 5
2: 5
3: 31
4: 211
Right 1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG 0: 1
1: 2
2: 6
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045605422 Original CRISPR CACTTTTTATGAGAAGCATA TGG Intronic
905353265 1:37362343-37362365 CACTTTTAAAGAGCAGCATCAGG + Intergenic
905754864 1:40500527-40500549 CAGCTTTTATGGGAACCATATGG + Intergenic
906666528 1:47626039-47626061 CACTTTCTGTGACAAGCACATGG + Intergenic
909064225 1:70914541-70914563 CAAGTTTTATGAGAAGAGTAAGG - Intronic
909918235 1:81347603-81347625 CACTTTTTATTATAAGCATAAGG - Intronic
912218067 1:107639392-107639414 CACAGATTAGGAGAAGCATATGG + Intronic
913207031 1:116548513-116548535 AACTTATTAGGAAAAGCATAAGG - Intronic
917278470 1:173356101-173356123 CACATTTTGTGAGAAAAATAAGG + Intergenic
919536102 1:198789816-198789838 CACTTTTTAGGATAAGAATAGGG + Intergenic
923192818 1:231636607-231636629 AACTTTTTTTGAAAAGCATAAGG + Intronic
1068098206 10:52518873-52518895 AACTTTTTATGAGAAGTAGCTGG - Intergenic
1068304665 10:55191830-55191852 CAATTTTCATGAGATTCATACGG + Intronic
1071043211 10:81339118-81339140 AAATGTTCATGAGAAGCATAAGG + Intergenic
1071125581 10:82331283-82331305 CCCTTTTTATGAAAAGCCTGAGG - Intronic
1071699696 10:87917039-87917061 CACTTTTTAAGAAAAGCAAATGG + Intronic
1071941955 10:90600410-90600432 CACTATTCATGAGAAGCACTAGG - Intergenic
1074227416 10:111498845-111498867 TACTTTTTATGAGAAGTGTGTGG - Intergenic
1074492675 10:113953323-113953345 CACTTTTTCTGGGAAGCCAATGG - Intergenic
1074558668 10:114515443-114515465 CACTCTGCATGAAAAGCATAAGG - Intronic
1074790568 10:116882572-116882594 TAATTTTTAGGAGAAGCAAATGG - Exonic
1076098459 10:127753675-127753697 GCCTTTCTCTGAGAAGCATAAGG + Intergenic
1076315483 10:129537433-129537455 CAGTTTCTATGAGAACCATCTGG + Intronic
1076587453 10:131559390-131559412 TAATTTTCATGAGAAGCATGAGG + Intergenic
1078633285 11:13025707-13025729 AACTTTTTAGGAGTTGCATAAGG - Intergenic
1087289784 11:96307766-96307788 CACTTTTTATGAGAAGAGACTGG - Intronic
1087780357 11:102295131-102295153 TACTTTTTATGAGAAGTGTATGG + Intergenic
1091523516 12:1272637-1272659 CTCTTTTTATGAGAAGACCATGG - Intronic
1091700757 12:2660009-2660031 TACCTTTTATGAGAAGCATATGG + Intronic
1092876301 12:12851056-12851078 TACTTTTTATGAGAAGCTTATGG + Intergenic
1094006179 12:25754359-25754381 CAGTTTTTTTGGGAAACATATGG - Intergenic
1094028162 12:25980984-25981006 TACTTTTTATGGGCAGTATAAGG + Intronic
1097391466 12:59020243-59020265 TACTTTTTATGAGAAGCGTATGG + Intergenic
1097801982 12:63924487-63924509 CAGTTTTTTGGAGGAGCATAAGG + Intronic
1099805519 12:87513812-87513834 CAATTTTTATGAAAAGCAAATGG - Intergenic
1102095793 12:110240155-110240177 CACTTTAGATGAGATGCATAGGG + Intergenic
1103065279 12:117892367-117892389 CTCTTTGTTTGAGAGGCATAAGG - Intronic
1103204968 12:119121529-119121551 CAATTTATAAGAGAAGCAAATGG - Intronic
1104120079 12:125790604-125790626 TATTTTTTGTGAGAAGCATGAGG - Intergenic
1108825043 13:54403227-54403249 CCCTTTTTTTGAGAAGCTTGTGG + Intergenic
1108980765 13:56510218-56510240 CACTTTTCAAAAGAAGCATGTGG - Intergenic
1109709008 13:66139648-66139670 CACTTTTTAAGAAAAAGATATGG + Intergenic
1110790866 13:79585303-79585325 CACTTTGTAAGAAGAGCATATGG + Intergenic
1112876721 13:104050819-104050841 CCATTTTTATGAGCAGAATATGG + Intergenic
1112898963 13:104336338-104336360 TACTTGTTATGAGAAGAATAGGG + Intergenic
1114423812 14:22605766-22605788 CTCTGTTTATGAGAAGCAAGAGG - Intronic
1115131296 14:30055274-30055296 TACCTTTTATGAGAAGCGTATGG + Intronic
1116139324 14:40970301-40970323 CAATTTTTATGAGAAGGATTAGG - Intergenic
1116439084 14:44930589-44930611 CACTTTCTTTGAGCATCATATGG - Intronic
1116606586 14:47005351-47005373 CACTTATTGAAAGAAGCATACGG + Intronic
1118668753 14:68099975-68099997 CACATTTTATGAGAGGAGTATGG + Intronic
1119366613 14:74097722-74097744 CACTTCTTATAAGAATAATAGGG + Intronic
1119453380 14:74732241-74732263 CACTTTTTATTAATAGGATAAGG + Intronic
1124071504 15:26397518-26397540 CACTTTTTAAGAGCAGCTTTGGG + Intergenic
1125776711 15:42222442-42222464 CACAGTTTATCAGAAGCCTAGGG + Intronic
1126314343 15:47353421-47353443 AACTCTTTGTTAGAAGCATACGG - Intronic
1127166254 15:56246555-56246577 CACATAATATGAGAAGCACATGG - Intronic
1127912860 15:63432469-63432491 CACTGTTTACCAGAAGCACAAGG - Intergenic
1130242548 15:82209981-82210003 CATTTATGATGAAAAGCATATGG + Intronic
1130457846 15:84130875-84130897 CATTTATGATGAAAAGCATATGG - Intergenic
1133561919 16:6958128-6958150 CACGTTTTTTGAGAAGCAAGGGG + Intronic
1135199259 16:20422596-20422618 AATTTTTTTTGAGAAGCATTGGG + Intronic
1136847635 16:33589238-33589260 CACTTGTTCTGAGAAGCAAGAGG - Intergenic
1137481298 16:48853826-48853848 CACTTTTTATGACTACCAGAAGG - Intergenic
1137881746 16:52056273-52056295 CAATTTTTATAAGAAGTAGATGG - Intronic
1138723855 16:59114413-59114435 TAATTTTTTTTAGAAGCATATGG + Intergenic
1140330919 16:74055994-74056016 CACTTTTTAAAAAATGCATATGG + Intergenic
1142341112 16:89523166-89523188 AACTCTTTATGAGAAGCACCAGG - Intronic
1203050026 16_KI270728v1_random:867184-867206 GCCTTCTTATGAGAAGCATTTGG + Intergenic
1203109343 16_KI270728v1_random:1437893-1437915 CACTTGTTCTGAGAAGCAAGAGG - Intergenic
1142464127 17:118652-118674 CACCATTTATGGGAAGGATATGG - Intergenic
1146977233 17:37124345-37124367 CACTTATGATTAGAAGAATAGGG - Intronic
1151066468 17:71156361-71156383 TACATTTTGTGAGAAACATATGG + Intergenic
1156527471 18:37780021-37780043 CAGAGTTTATGAGAAGCACACGG - Intergenic
1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG + Intergenic
1158421156 18:57295741-57295763 CATATTTTATGAGAAGCAATAGG + Intergenic
1158636844 18:59166362-59166384 CTCTTCTCATGAGAAGCATGTGG - Intergenic
1159171733 18:64777962-64777984 CATTTCTTCTGTGAAGCATATGG + Intergenic
1159247817 18:65832189-65832211 CATTATTTATGAAAAGGATATGG - Intronic
1162762042 19:12894207-12894229 TACTTTTTATGAGAAGCGTATGG + Intronic
1163856538 19:19706880-19706902 CACTTTTTGTGAGAGGCTTGGGG - Intergenic
1165509690 19:36258796-36258818 CCCTGTTTCTGAGAAGCCTAGGG + Intergenic
1165510716 19:36265341-36265363 CCCTGTTTCTGAGAAGCCTAGGG + Intergenic
1165511214 19:36267760-36267782 CCCTATTTCTGAGAAGCCTAGGG + Intergenic
1166440581 19:42811019-42811041 AACTTTTTATAAGATACATATGG + Intronic
1166477362 19:43139610-43139632 AACTTTTTATAAGATACATATGG + Intronic
929375615 2:41283311-41283333 TAGTTTCTATGGGAAGCATAGGG - Intergenic
931982067 2:67704482-67704504 CACTTTTTATCAAAACAATATGG - Intergenic
935444740 2:103144244-103144266 CACTTATTTTGAGAAACATCAGG - Intergenic
935902750 2:107810147-107810169 CAGTTTGTATGAGCAGCTTAAGG - Intergenic
939832867 2:147093624-147093646 CACTTTTTATAATGAGAATAGGG - Intergenic
940517800 2:154702685-154702707 CTCTTTTTATGAGTAGAAAAAGG - Intronic
940549748 2:155139002-155139024 GACTTTTTATCAGAATAATAAGG - Intergenic
940703358 2:157074123-157074145 CAATTTGTATAAGAAGCACAGGG + Intergenic
942725479 2:179002126-179002148 TACTTTTTATGACAAGCACATGG + Intronic
943152208 2:184128971-184128993 AACTTTTTATAAGAAAAATATGG + Intergenic
944326019 2:198404653-198404675 CACTTTTAATGAATAGAATATGG - Intronic
944418633 2:199504693-199504715 CACTTGTAATGAGTAGAATATGG + Intergenic
944430267 2:199625653-199625675 CATTTTTTATTTGTAGCATATGG - Intergenic
948881421 2:240859319-240859341 AACTTTTAAAAAGAAGCATATGG + Intergenic
1170475638 20:16711647-16711669 CAGTTTTAATCAGAAGCATAGGG - Intergenic
1173507965 20:43603850-43603872 AACTTTTTACTAGAAGAATATGG + Exonic
1174459257 20:50671298-50671320 CACTTCTAATGAGCAGAATATGG + Intronic
1175018847 20:55822792-55822814 CCCTTCTTAAGAGAAGCAGATGG + Intergenic
1175362027 20:58419852-58419874 CAATTTTTATAGGAAGAATAGGG + Intronic
1176907295 21:14517479-14517501 CAATTTCTATGAGAAGCAAGAGG - Intronic
1176944566 21:14963439-14963461 CACTTTTTATGACAAAAATTGGG - Exonic
1176958705 21:15135352-15135374 CATTTTTTATGATAATCATAGGG + Intergenic
1177277466 21:18931687-18931709 CACTTAGTAAGAGAAGCAGATGG - Intergenic
1178072478 21:28983985-28984007 AACTTTTTATGAGAAAGTTATGG + Intronic
1178094719 21:29201694-29201716 GACTTTTTGTGAGAAGTATTTGG + Intronic
1179229159 21:39485617-39485639 AACTTTTGTTGAGAAGCAGATGG - Intronic
1183007963 22:34918998-34919020 CACTCTTCATGGGAAGCATAAGG + Intergenic
955191330 3:56764476-56764498 GACTTTTTGTGATAAGCCTACGG + Intronic
956299650 3:67757499-67757521 TAATTTTTGTGAAAAGCATAAGG - Intergenic
957540896 3:81567565-81567587 CACTTTGTATGAGACAAATAAGG - Intronic
957978332 3:87475160-87475182 CACTTATTATCACAAGCATAGGG - Intergenic
958079916 3:88734119-88734141 CATTTTTTATGAAAAGAAAAAGG + Intergenic
958613349 3:96456705-96456727 CCCTTTTTATAAGATGCATATGG - Intergenic
959101734 3:102017687-102017709 CTCTGTTTTTGAGAAGCTTAGGG + Intergenic
959717412 3:109448192-109448214 CACTGGTCATCAGAAGCATATGG - Intergenic
962050231 3:131805901-131805923 CACATTTTAAGAGGAGCATGTGG + Intronic
966296792 3:178432973-178432995 AGCTTTCTATCAGAAGCATATGG + Intronic
969061767 4:4441285-4441307 CACTTTTTAAGAAGAGCATGTGG + Intronic
972082235 4:35167547-35167569 CAATTTTCATCAGAAGCAGATGG - Intergenic
975298438 4:72761636-72761658 CACATATTTTGAGAAGCATCTGG - Intergenic
976191948 4:82495797-82495819 TACTTTTTATGAGAAGCATATGG - Intronic
977352007 4:95900392-95900414 CACTTTGTATAGCAAGCATATGG - Intergenic
977440581 4:97061772-97061794 CTCTTTTTGTGAGAAGAATTTGG + Intergenic
977992182 4:103457486-103457508 CTCTTTTTATGATAAAAATAAGG - Intergenic
978102979 4:104865717-104865739 AACTTGGTATGAGAAGCACATGG + Intergenic
978461557 4:108959691-108959713 CACATTTTATTAGAAGTACATGG + Intronic
980617095 4:135243345-135243367 GACTTTTTAGGAGAAGAAAAAGG - Intergenic
981228390 4:142323816-142323838 CCCTTTTTATGTGAGGCAAATGG + Intronic
984022191 4:174499096-174499118 CAATTTTTATTTGAAGCACATGG - Intronic
984569912 4:181379893-181379915 CATTTTATCTGAGAAGCATAAGG + Intergenic
986908379 5:12522571-12522593 CACATTTCATTAGAAGCTTAAGG + Intergenic
987107661 5:14656431-14656453 TACCTTTTAGGACAAGCATATGG - Intergenic
987458224 5:18173270-18173292 CACTTTTTAAAAGAAGTAGAAGG - Intergenic
990219248 5:53569040-53569062 ACATTTTTAGGAGAAGCATATGG - Intronic
990331267 5:54728293-54728315 CAATTTTTTTAAGAAGGATAAGG + Intergenic
990766521 5:59189806-59189828 CACTTTTTCTGAGGACCAAAGGG + Intronic
991478332 5:67047896-67047918 CACTTTTTCTGAATAGCACAAGG - Intronic
991576697 5:68111860-68111882 GATTTTTTTTGAGAAGTATATGG + Intergenic
991992917 5:72359148-72359170 CACTTATTTTGAAAAGCACATGG - Exonic
992995739 5:82330761-82330783 TACTTCTTTTGAGAACCATATGG - Intronic
993128031 5:83859439-83859461 CAATTGTTATTACAAGCATAAGG + Intergenic
993902527 5:93594509-93594531 CACTCATTATAAGAAGCAAAGGG - Exonic
995502439 5:112822375-112822397 CACTTTTGATGAGCATCAGAGGG + Intronic
998975358 5:147639841-147639863 CACTTTTTACAAGAAGTAAAAGG + Intronic
1000188756 5:158887602-158887624 CAATTCTTAAGAAAAGCATATGG + Intronic
1000281179 5:159783701-159783723 CTCTTTCTATGAGAAGCACTGGG - Intergenic
1003765130 6:9227496-9227518 TTCTTTTTATGCGAAGAATATGG - Intergenic
1004735008 6:18396843-18396865 CTCTCTTTATGATAAACATACGG - Intronic
1005531483 6:26711176-26711198 CACTTTTCAGGAGAAGAATCAGG + Intergenic
1005539312 6:26790486-26790508 CACTTTTCAGGAGAAGAATCAGG - Intergenic
1005649175 6:27870876-27870898 CACAGTCTATGACAAGCATATGG + Intergenic
1007997450 6:46323338-46323360 CACATTATATGAGAAGACTAAGG + Intronic
1009010143 6:57832705-57832727 CACTTTTCAGGAGAAGAATCAGG - Intergenic
1010247584 6:73676137-73676159 CACTGTTTATGAGAAGTCAAAGG + Intergenic
1011729613 6:90247699-90247721 CCCTTTTTAACTGAAGCATAGGG - Intronic
1011899068 6:92269666-92269688 TAGTTATTATGAGAATCATAAGG - Intergenic
1012803149 6:103860448-103860470 CAATTTCTATGCAAAGCATATGG - Intergenic
1013534700 6:111053302-111053324 CACTTTTTATGCGTGGCAGATGG - Intergenic
1018682837 6:166278113-166278135 GACTATTTATGTGAAGCATCTGG - Intergenic
1024023934 7:45395559-45395581 AACTTTTTATGAGAAATAAAGGG - Intergenic
1024525918 7:50349390-50349412 CAGTTTTGATGAGAAGCGCATGG + Intronic
1025093049 7:56078682-56078704 CACTTGCTATGAAAAGCAAAGGG + Intronic
1028732053 7:94162078-94162100 CAGTTTTGATGGGAAGTATATGG + Intergenic
1031421644 7:121559272-121559294 GACTTTCTATGTGAAGCATCTGG - Intergenic
1035071544 7:156148563-156148585 CACTTTTTATGGAAAGGATTTGG + Intergenic
1035869191 8:3118777-3118799 CACTATTTATTAAATGCATATGG - Intronic
1037418068 8:18672824-18672846 TACTTTTTAAGAAAAGCAAAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038738896 8:30199207-30199229 CACTTTGTCTGAGAAACAGAGGG + Intergenic
1038935423 8:32244589-32244611 CACTTTTTTCTAGAAGCATAGGG + Intronic
1042571877 8:70174253-70174275 GAACTTTTAAGAGAAGCATAAGG - Intronic
1043313219 8:78887729-78887751 CACTTTTTATGTAGAGCACATGG + Intergenic
1043451296 8:80369995-80370017 CATCTTTTATAAGCAGCATATGG - Intergenic
1044167760 8:89008608-89008630 TACTCTTAATGAAAAGCATAGGG - Intergenic
1045594772 8:103640613-103640635 CACATATTTTTAGAAGCATATGG + Intronic
1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG + Intronic
1046022876 8:108687669-108687691 CACTCTTTATGAGAATCTAATGG - Intronic
1046492933 8:114976584-114976606 CAATTTTTAGGTAAAGCATAAGG - Intergenic
1046502452 8:115096273-115096295 CCCATTTTATGAGAAGCACATGG + Intergenic
1046867678 8:119169214-119169236 CACTTTTTATGAAAAGTACATGG - Intronic
1046992993 8:120481823-120481845 CACTTTTTGTAAGAATCATTCGG + Intronic
1047028678 8:120852295-120852317 CAGTTTCCATGAGAAGGATATGG + Intergenic
1047064392 8:121264096-121264118 CACTTCATATAAAAAGCATATGG - Intergenic
1047161370 8:122383926-122383948 CAATTTCTATGACAAGCACAGGG - Intergenic
1047793195 8:128226537-128226559 CACTTCTAATGAGCAGAATAAGG + Intergenic
1048110494 8:131462626-131462648 TACTTTTTATGAAAATCAGAAGG - Intergenic
1048857110 8:138694878-138694900 CCCTGTTGGTGAGAAGCATAGGG + Exonic
1050340506 9:4633103-4633125 TACTTTTTATGAGAAGCATATGG + Intronic
1050454579 9:5821456-5821478 CTCTTTTTATTAAATGCATATGG - Intronic
1051638255 9:19200950-19200972 TACTTTTTATGAGAAACGTACGG - Intergenic
1051655660 9:19379528-19379550 TACTTTCTATGAGAAGCGTATGG - Exonic
1051875556 9:21789608-21789630 CACTTCTTATGACCAGCAGATGG - Intergenic
1051927479 9:22346510-22346532 CACTTTATTTGAGATACATATGG + Intergenic
1052099952 9:24433746-24433768 GACTTTTTATGAGAAGTAGGTGG + Intergenic
1053843937 9:42216582-42216604 TAATTTTTGTGAGAAGTATAAGG + Intergenic
1056316347 9:85394380-85394402 CCCTTATTTTGAGAAGCATACGG + Intergenic
1056415852 9:86375616-86375638 TACTTTTTATGAGAAGCCTATGG - Intergenic
1058616679 9:106836815-106836837 GATTTTTTATGAGAAGAATCTGG - Intergenic
1059816189 9:117918409-117918431 CAGGTTCTATGAGAAGAATAGGG + Intergenic
1185541799 X:908207-908229 CACTTTCTATGAAACGCAAAAGG - Intergenic
1188113098 X:26215225-26215247 CACTTTCTATGAGAGGCTTCTGG - Intergenic
1189066383 X:37813888-37813910 CACTATTTAGGAAATGCATAGGG + Intronic
1190033048 X:46992607-46992629 CCGTTTTTATAAGAAGCAAATGG - Intronic
1192790403 X:74376789-74376811 TACTTTTTATGAGAAGTGTATGG - Intergenic
1194072005 X:89337580-89337602 CTCTTTCTGTTAGAAGCATAAGG - Intergenic
1194574000 X:95589057-95589079 CCCTTTTTGTGAGAAGTGTAAGG + Intergenic
1197310716 X:124901797-124901819 CACTTTTTAGAGGAAGCATGGGG - Intronic
1197456833 X:126686954-126686976 CACATTTTATAATAATCATAAGG - Intergenic
1197849741 X:130844954-130844976 CACTGTTTATGAGAACTAAATGG - Intronic
1198035369 X:132796422-132796444 CTCTTTTTATTGAAAGCATATGG - Intronic
1200726248 Y:6673317-6673339 CTCTTTCTGTTAGAAGCATAAGG - Intergenic