ID: 1045607702

View in Genome Browser
Species Human (GRCh38)
Location 8:103795964-103795986
Sequence TGGTGCAATAAGATGGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 6, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045607702_1045607706 -7 Left 1045607702 8:103795964-103795986 CCCTAGCCCATCTTATTGCACCA 0: 1
1: 0
2: 6
3: 6
4: 91
Right 1045607706 8:103795980-103796002 TGCACCATCAATCATTCTTATGG No data
1045607702_1045607708 12 Left 1045607702 8:103795964-103795986 CCCTAGCCCATCTTATTGCACCA 0: 1
1: 0
2: 6
3: 6
4: 91
Right 1045607708 8:103795999-103796021 ATGGCCATTTAAAGATACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045607702 Original CRISPR TGGTGCAATAAGATGGGCTA GGG (reversed) Intronic
903016387 1:20364810-20364832 TGCTGCAATAAGATGGGGGGAGG + Intergenic
903873521 1:26455348-26455370 TTGAGCAATAAGAAGGGCTCTGG - Intronic
906127647 1:43437382-43437404 TGGGGGAATAACATGGGCTCAGG - Intronic
906330683 1:44881575-44881597 TGGTTCAGTAAGAGGGGCAAGGG - Intronic
909107165 1:71426093-71426115 TGGGGAAATAAGATGAGCTAAGG - Intronic
913016012 1:114736034-114736056 TGGTACCATAAACTGGGCTAAGG - Intronic
921089985 1:211833093-211833115 TGGTGCAATAAAATAGGCTATGG - Intergenic
923352135 1:233118375-233118397 TAGTGCAATAAGACTGGCAAAGG + Intronic
1066226174 10:33385901-33385923 TGGGGCAAAGAAATGGGCTATGG - Intergenic
1066638256 10:37529195-37529217 CGTTGCAATCAGATGGGCTTGGG - Intergenic
1067257750 10:44661005-44661027 TGGTGAAATCAGAGGGGATAAGG - Intergenic
1067824875 10:49563646-49563668 TGTTGCATTGAGATGGGCTCTGG - Intergenic
1070714607 10:78710195-78710217 TGGAGCTAAAAGATAGGCTATGG + Intergenic
1072658508 10:97347503-97347525 TGGTGCATTAGGATGGGGTGGGG - Intergenic
1073700401 10:105920226-105920248 AGCTGCAATAATATGGGATAAGG + Intergenic
1074702485 10:116104625-116104647 TGATGCAATCAGAAAGGCTAAGG - Intronic
1080861154 11:36151306-36151328 TTGTGTAGTAAGATGGGCCAGGG + Intronic
1086016707 11:82176752-82176774 TTGACCAAGAAGATGGGCTAAGG + Intergenic
1090247660 11:125228323-125228345 TGGTGCAATAAGGTAGCCAAGGG - Intronic
1091179261 11:133588821-133588843 TGGTGCAATACGATGGAGGAGGG - Intergenic
1091411061 12:239564-239586 TCGTGTTAGAAGATGGGCTATGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1096960990 12:55577421-55577443 GGGTGGAATAATATGGGCTTGGG - Intergenic
1097983266 12:65755844-65755866 TGGTGGAGAAAGATGGGCTTGGG + Intergenic
1100178136 12:92053831-92053853 TGGTGGAACAAAATGGGCTTTGG - Intronic
1102708731 12:114906257-114906279 AGGATCAATAAGATGGGCTGAGG + Intergenic
1107452642 13:40524733-40524755 TAGTGCAATAAGACAGGCAAAGG + Intergenic
1111863118 13:93733654-93733676 TGGTACCATGAGATGGACTATGG - Intronic
1115350761 14:32392654-32392676 TGGTGTAATAAGATGCTCTAGGG - Intronic
1116684957 14:48027540-48027562 TGGTGGATTAAAATGGGCCACGG + Intergenic
1117741041 14:58819686-58819708 TGGAGCAATAAAATGGGGAAAGG + Intergenic
1117884315 14:60343692-60343714 TGATGCACTATGATGTGCTAAGG - Intergenic
1126659091 15:51013887-51013909 TGTTGCAGTAAGATGGACAATGG + Intergenic
1128519757 15:68367549-68367571 TGCTGTAATAAGAGTGGCTAGGG - Intronic
1128533055 15:68468345-68468367 TGGTGCAATAAGATGCAGTGAGG + Intergenic
1132376944 15:101334604-101334626 TGGTGCACTGAGATTGGCTGGGG + Intronic
1136518878 16:30784006-30784028 TGGTCCAGTCAGATGGGGTAGGG + Exonic
1143428670 17:6862633-6862655 TGCTGCAATAAGAGGGGCTAAGG + Intergenic
1144490964 17:15708644-15708666 TGGTGCTATAAGTTAGGATAAGG - Intronic
1152980463 18:271401-271423 TGGTGAAGTAAGATGGACGAAGG + Intergenic
1155433631 18:25787924-25787946 TGGTGAAACAAGATGGGAGATGG - Intergenic
1158135565 18:54204056-54204078 TAGTGGAATAAGAAGGGCTTTGG - Intronic
1159434694 18:68400517-68400539 TGATGCAATAAGATGAGAAAAGG + Intergenic
1160603559 18:80032901-80032923 GGGAACAATCAGATGGGCTAGGG - Intronic
1163117836 19:15199089-15199111 GGGTCCCATAACATGGGCTATGG + Intronic
1168623769 19:57900466-57900488 TGCAGCATTAAGATGGGTTAAGG - Intronic
928081870 2:28319169-28319191 TGGTGCACTAACATGGGCATGGG - Intronic
929791086 2:45023641-45023663 TGGTGCAGTAGGATGGGGTGAGG - Intergenic
930879946 2:56259389-56259411 TGGAGCAATAGGCTGGGATATGG - Intronic
933222763 2:79709746-79709768 TGGAGAAATAGGATGGGGTAGGG + Intronic
933770824 2:85742863-85742885 TGGGGGAATAAGGTGGGCTGGGG + Intergenic
938582932 2:132663671-132663693 TGAATCAATCAGATGGGCTATGG - Intronic
940254571 2:151715073-151715095 TGGAGTAATAATATGAGCTAAGG - Intronic
941163711 2:162063215-162063237 TGCTGAAATAAGATGTACTAAGG + Intronic
943254947 2:185583176-185583198 TGGTGAACTAACATGGCCTATGG + Intergenic
943607150 2:189988989-189989011 CAATGCAATGAGATGGGCTAGGG + Intronic
946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG + Intronic
948514366 2:238494472-238494494 AAGTGCAATAAAAAGGGCTAAGG - Intergenic
1173379640 20:42528284-42528306 TGGTGCTATTAGATGGTATATGG - Intronic
1177824856 21:26071280-26071302 TGGGGTAATAGGATGGGCTAGGG - Intronic
1179391072 21:40991835-40991857 TGCTGCAACAAGTTGAGCTAAGG - Intergenic
1182960903 22:34474355-34474377 TGCTACAATAAGATGAGATATGG - Intergenic
949681744 3:6521539-6521561 TGATGCAATGAGATAGGCTCTGG - Intergenic
954360203 3:50118141-50118163 TGGAGGAATAAAATGGGCTACGG - Intronic
956599524 3:71004956-71004978 TGTTGAAATAAAAAGGGCTATGG + Intronic
958518298 3:95150052-95150074 AGGTGCCAAAAGATGGGCAATGG + Intergenic
962175647 3:133151288-133151310 TGGTGCCATAAACTGGGTTAGGG - Intronic
967170005 3:186815667-186815689 TGCTGCAATAAAATGGGCTTTGG + Intergenic
967810591 3:193757396-193757418 TGCTGCAATAAAAAGAGCTAAGG - Intergenic
975527069 4:75362485-75362507 TGGTACAATAAAATAAGCTAGGG + Intergenic
977058331 4:92221912-92221934 TTGTGCATTAAGATGTGATATGG - Intergenic
979549150 4:121970758-121970780 TGCTGCAAGAACATGGGCTGGGG - Intergenic
986811626 5:11365844-11365866 TGGGGCAATGAGATGGCCTTGGG + Intronic
988717839 5:33845326-33845348 TGGGACAATAAGATGTTCTAGGG - Intronic
989577468 5:43001462-43001484 TGGTGCAATAAGGTGAGAAAAGG - Intergenic
992762805 5:79966064-79966086 TGGTCCAATGAGCTGAGCTAGGG + Intergenic
993471175 5:88309365-88309387 TGGTGTCATAAAATGAGCTAGGG - Intergenic
993541352 5:89156517-89156539 AGGGGAAATAAGAAGGGCTATGG + Intergenic
998545348 5:143022978-143023000 TGGTGCACTAAGAAGGAATATGG - Intronic
999410943 5:151349340-151349362 TGGTGCAATGAGTTGGGGTGTGG - Intergenic
1005152206 6:22765258-22765280 TGGTGAAAGAAGAACGGCTAAGG - Intergenic
1007243043 6:40440827-40440849 TGGGGAAATGAGATGGGCAAAGG - Intronic
1009515051 6:64604795-64604817 AGGTGCAATAAGAAGGGAAATGG + Intronic
1016212066 6:141549193-141549215 TGCTGAAATAACATGCGCTAAGG + Intergenic
1022027094 7:26458918-26458940 TGAGGCAATAATATGGGCTGGGG + Intergenic
1025001709 7:55320802-55320824 TGATGAAATAAGCTTGGCTATGG - Intergenic
1026568762 7:71511399-71511421 TGTTGCAATAAAATTGCCTAGGG - Intronic
1030619191 7:111770901-111770923 AGTTGCAATAAGAAGGGCCAGGG + Intronic
1035539059 8:417476-417498 TGGTGCAGTAAGAGGGTCGAGGG + Intronic
1045607702 8:103795964-103795986 TGGTGCAATAAGATGGGCTAGGG - Intronic
1045827513 8:106416810-106416832 TGGTGAAATAAGAAGGGCCTTGG - Intronic
1047571260 8:126100811-126100833 TGGTGCATTAACTTGGGCTAAGG + Intergenic
1049242241 8:141543896-141543918 TGGTGCCAGGAGGTGGGCTAGGG - Intergenic
1053608761 9:39688172-39688194 TGGTGGAATCAGATGGGCTATGG - Intergenic
1053866606 9:42444538-42444560 TGGTGGAATCAGATGGGCTATGG - Intergenic
1054244763 9:62654226-62654248 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054558890 9:66688769-66688791 TGGTGGAATCAGATGGGCTATGG + Intergenic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1059842234 9:118230538-118230560 TGGTGCAAAAAGGTGGGGTTGGG - Intergenic
1190446389 X:50529258-50529280 TGGTGCAAGAAAATAGACTATGG - Intergenic
1195461721 X:105134347-105134369 TAGTTCAATAACATGGGGTAAGG - Intronic
1196369854 X:114965221-114965243 TGGTGCAATATCATGGGCCTGGG + Intergenic
1200279936 X:154768583-154768605 TGGGACATTAAAATGGGCTAAGG + Intronic
1201402258 Y:13615811-13615833 TGCAGCATTAAGATGGGATAAGG + Intergenic