ID: 1045610086

View in Genome Browser
Species Human (GRCh38)
Location 8:103829582-103829604
Sequence TATCCTAACCAATTTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045610082_1045610086 11 Left 1045610082 8:103829548-103829570 CCTTTGCAGCAACATAGATCGAG 0: 1
1: 57
2: 854
3: 2932
4: 5574
Right 1045610086 8:103829582-103829604 TATCCTAACCAATTTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045610086 Original CRISPR TATCCTAACCAATTTGATGC AGG Intronic
No off target data available for this crispr