ID: 1045625605

View in Genome Browser
Species Human (GRCh38)
Location 8:104044767-104044789
Sequence ATGTCTCCCTTACAGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045625605_1045625608 6 Left 1045625605 8:104044767-104044789 CCCTAATACTGTAAGGGAGACAT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1045625608 8:104044796-104044818 TGTTAACCAGCATTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045625605 Original CRISPR ATGTCTCCCTTACAGTATTA GGG (reversed) Intronic
904949034 1:34221073-34221095 TTATCTCCCTTAGACTATTATGG - Intergenic
905603180 1:39271479-39271501 AGGTCCCACTTCCAGTATTAGGG + Intronic
909879241 1:80852212-80852234 TTGCCTCTCTTCCAGTATTAAGG + Intergenic
911516314 1:98872272-98872294 ATGTCTCCCTTAAAGGAACAGGG - Intergenic
912322053 1:108722632-108722654 ACGTCTCCCTTACAGCAGTCAGG - Intronic
916247392 1:162702728-162702750 ATGTCTTCCTCACATTATGAAGG + Intronic
917253199 1:173085153-173085175 CTGTGTACCTGACAGTATTATGG + Intergenic
918695333 1:187539568-187539590 TTATCTCCCTTCCAGTATGAAGG - Intergenic
922326969 1:224536921-224536943 GTGTCTTCCTTACAGGATTGTGG + Intronic
923693402 1:236220588-236220610 ATATCTCCCTTACAAAATTAAGG + Intronic
923716819 1:236432044-236432066 ATGTTTTCCTTAAAGTATCATGG - Intronic
1070854747 10:79598138-79598160 AGCTCTCCCAGACAGTATTAAGG - Intergenic
1071959428 10:90795741-90795763 ATGTCTTCCTTAATGTATAAAGG - Intronic
1079909686 11:26294252-26294274 ATGGCTCTCTAACAGTCTTACGG - Intergenic
1080946067 11:36976866-36976888 TGGGCTTCCTTACAGTATTATGG - Intergenic
1081550998 11:44112539-44112561 AGGTCTCCATTACATTATAATGG - Intronic
1081928034 11:46846780-46846802 ATGTTTCCCTTACAATTTAATGG + Intergenic
1084796654 11:71510678-71510700 ATGTCTACCTTAGAGTTTTCAGG + Intronic
1085845019 11:80055200-80055222 ATGGCTCTAATACAGTATTATGG - Intergenic
1087171246 11:95051644-95051666 ATACCTCCCTTACAGTGCTATGG + Intergenic
1091508685 12:1099521-1099543 ATTACTCTCTTACAGTATTGTGG + Intronic
1093371394 12:18370146-18370168 ATGTCTCCCTGCCCCTATTAGGG + Intronic
1094082118 12:26548444-26548466 ATCTCTTCCCTACACTATTAAGG + Intronic
1095328082 12:40922554-40922576 TTGTCTCCATTACACAATTAGGG - Intronic
1097059671 12:56273247-56273269 TCTTCTACCTTACAGTATTATGG - Exonic
1101055629 12:100909870-100909892 ATACCTACCTTATAGTATTAGGG + Intronic
1102743073 12:115225028-115225050 ATATCTACCTTACAGGGTTACGG + Intergenic
1104271408 12:127285785-127285807 GTTTCTCCATTACAGTTTTATGG + Intergenic
1106986635 13:35359992-35360014 ATGTCTTCCTTACAGTTGTTAGG - Intronic
1108247834 13:48534998-48535020 CTGTCTTCCTTACAGTCTCAAGG + Intergenic
1110834476 13:80067667-80067689 ATATCTCCCTTACAATGTTAAGG - Intergenic
1115870049 14:37790090-37790112 TTTTCTCCCTTCCATTATTAGGG + Intronic
1116709203 14:48343658-48343680 ATGTCTCCATTACAAAGTTAGGG + Intergenic
1120641658 14:87020704-87020726 ATGTCTCACCTACAGCCTTAAGG - Intergenic
1122911327 14:104829262-104829284 ATGTATTCCTCACAGTTTTAGGG - Intergenic
1130219985 15:82011312-82011334 CTGTCTACCATACAGGATTAAGG - Intergenic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1133708700 16:8380279-8380301 ATATCTGTCTTACAGGATTATGG - Intergenic
1135019451 16:18951329-18951351 ATGACTCCTTTACAGTATCATGG + Intergenic
1137927971 16:52559436-52559458 AGCCCTCCCTTACAGTATCAAGG - Intergenic
1138162715 16:54770815-54770837 ATGTCTCCCTTTGAATATTTGGG - Intergenic
1140293784 16:73688614-73688636 ATGTGTTGCTTACAGTTTTAGGG - Intergenic
1140837074 16:78804855-78804877 ATGTAGCCATGACAGTATTACGG + Intronic
1141269911 16:82529772-82529794 ATGTCTCCTTTCCAGTATCAAGG - Intergenic
1143387508 17:6540540-6540562 ATGTCTCCCTTTTATTATTGCGG + Intronic
1147749307 17:42718927-42718949 ATGCCCCCCTTACTATATTAAGG - Intronic
1149674673 17:58448803-58448825 ATATCACAATTACAGTATTAGGG - Intronic
1151091890 17:71449681-71449703 ATTTCTCCCTTTCAGTCTTCTGG + Intergenic
1152944466 17:83191491-83191513 ATGTCTCTCTCCCAGAATTAAGG - Intergenic
1155418226 18:25625100-25625122 ATATCACCATTACAGTATTATGG + Intergenic
1156933630 18:42675944-42675966 ATGTTTACCTCACAGGATTATGG - Intergenic
1162477466 19:10909088-10909110 ATGTCTCTGTTCCAGTTTTATGG + Exonic
1167881699 19:52464542-52464564 ATGACTCCTTTTCAGTATTTGGG - Intronic
928697959 2:33869514-33869536 AGTTCTCCCAGACAGTATTAAGG - Intergenic
930860582 2:56068602-56068624 CTATCACCATTACAGTATTAGGG + Intergenic
931879139 2:66548482-66548504 ATTTCTTCCTTTCAGTATTCAGG - Intronic
933228024 2:79773416-79773438 ATGTCTCCCGTTCAGAAATATGG + Intronic
936642561 2:114331464-114331486 ATGTCTTCCTAACTGTTTTAAGG + Intergenic
939593083 2:144090212-144090234 ATGTGTCCCTTACCGGATTGAGG - Intronic
941435244 2:165462384-165462406 ATTTCTCCCAGACAGTATTATGG - Intergenic
945914158 2:215684896-215684918 ATGTCTCCCTGACACTAGGAGGG - Intergenic
946544787 2:220727467-220727489 ATGTTTCCATTGCATTATTAAGG - Intergenic
948981594 2:241497525-241497547 ATGTCTCCCTCACAGCACTGTGG - Intronic
1173637051 20:44569090-44569112 ATGTCCCCCCTACATTTTTAAGG + Intronic
950894482 3:16435991-16436013 ATTTCCCCCATAGAGTATTATGG + Intronic
955615370 3:60801374-60801396 TTGTCTCCCTTTCTGTATTAGGG - Intronic
955925681 3:64002300-64002322 CTGCCTCCTTTACAGTTTTAAGG + Exonic
956782625 3:72616266-72616288 ATGTATCCCTAACAGTATCTGGG + Intergenic
959388980 3:105749410-105749432 ATATATTCCTTAGAGTATTAAGG + Intronic
966327837 3:178777022-178777044 ATATCTCTCTTAAAGTATTATGG - Intronic
966691196 3:182743199-182743221 ATGTCTCCCATAGAATATAAAGG + Intergenic
967271015 3:187732706-187732728 ATGTCTACCTTATAGTGTTGTGG + Intronic
967799951 3:193646125-193646147 ATATTTCTCTTACAGTATTGGGG + Intronic
970542491 4:17094028-17094050 ATGTTGCCCTTTCAGTTTTAGGG - Intergenic
970992590 4:22230072-22230094 ATGTCTACCTAACAGTTTTACGG + Intergenic
971460576 4:26891327-26891349 ATGTCTAGGTTACAGTCTTAAGG - Intronic
972042523 4:34621853-34621875 ATGTGACCCTTACAATATTTAGG + Intergenic
974497483 4:62650942-62650964 ATGACTGCCCTACAGTATTTCGG - Intergenic
974844704 4:67337873-67337895 ATGTCTCCCTTAGACTTTCAGGG + Intergenic
975574613 4:75850296-75850318 ATTTCTCTATTACAGTATTGAGG - Intergenic
976522164 4:86041076-86041098 ATACCACCATTACAGTATTAGGG - Intronic
976688425 4:87842012-87842034 ATATCTACCTTTCAGTATTTTGG - Intronic
977106644 4:92894233-92894255 AGGTCTCCTTTACCGTGTTATGG + Intronic
978260467 4:106751245-106751267 ATGTCTCCATCACAGCATTTGGG + Intergenic
980306697 4:131070582-131070604 ATTTCTCACTTAGAGAATTAAGG + Intergenic
980334155 4:131447950-131447972 ATGTATCTCATACAATATTAAGG - Intergenic
981356215 4:143792372-143792394 ATGTGTCCCTTCCAAAATTAAGG + Intergenic
981377532 4:144033254-144033276 ATGTGTCCCTTCCAAAATTAAGG + Intergenic
982518027 4:156376905-156376927 ATGTCTACATTAAAGTAATATGG + Intergenic
982952917 4:161722947-161722969 ATGTCACCCTTACATTTATAGGG + Intronic
984434593 4:179693016-179693038 ATGTATTTCTTACATTATTATGG + Intergenic
984876047 4:184368585-184368607 GTGTCTCCCTCTCAGTATCAGGG - Intergenic
985034858 4:185828414-185828436 ATCTCTCCCTTTCAGAACTAAGG - Intronic
989490220 5:42042528-42042550 ATGTCAACCTTACTGTCTTAGGG - Intergenic
990622662 5:57577684-57577706 TTGTCTGCCATACAGTATTTTGG + Intergenic
993547174 5:89227754-89227776 ATGCCATCATTACAGTATTAGGG + Intergenic
993602111 5:89939521-89939543 CAGTCTGTCTTACAGTATTATGG - Intergenic
1003515532 6:6815287-6815309 ATGTCTGCCATGCATTATTAAGG + Intergenic
1006250373 6:32778435-32778457 ATGTCTCACCTCCAGTCTTAAGG + Intergenic
1007557012 6:42774650-42774672 GTGTCACTTTTACAGTATTAGGG + Intronic
1008121839 6:47627331-47627353 ATTTCTACTTTACAGGATTATGG + Intergenic
1008541406 6:52549413-52549435 TTGTCTCCCTCAAAGTATAAAGG + Intronic
1008549312 6:52612381-52612403 TTGTGTCCTTTACAGTTTTAGGG - Intergenic
1010089680 6:71965931-71965953 TTGTGTCTCTTAAAGTATTAGGG + Intronic
1013999899 6:116353013-116353035 ATCTCTCTCTTACCCTATTAAGG - Intronic
1014242500 6:119033198-119033220 ATGTCATCCTTACTGTATAAGGG + Intronic
1014798752 6:125754612-125754634 ATGACTTCCTTACAATATTAGGG - Intronic
1015480077 6:133699050-133699072 ATGTTTCGGTAACAGTATTATGG + Intergenic
1018251918 6:161880476-161880498 ATTTTTCCCCCACAGTATTAGGG + Intronic
1022136199 7:27451372-27451394 ATTTCTAACTTACTGTATTAAGG + Intergenic
1027406070 7:77862242-77862264 ATGTCTTTTTTACAGTGTTAAGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028740944 7:94274222-94274244 AGGTCTCCCAGACAGTATCAAGG - Intergenic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1031198982 7:118653730-118653752 AATTCTCCCTCACAGGATTAAGG - Intergenic
1032585653 7:133143869-133143891 ATACCTCCCTTGCAGTATTGTGG - Intergenic
1032932750 7:136693077-136693099 ATGTCTACCTCACAGTGTTTTGG - Intergenic
1038052000 8:23822698-23822720 ATGTCTCCCTTTCTGCTTTAAGG + Intergenic
1040726582 8:50387958-50387980 ATGTCTTCCTTCCAATATTCAGG + Intronic
1041598608 8:59687953-59687975 AAGTCTCTTCTACAGTATTACGG + Intergenic
1041715273 8:60926544-60926566 CTGTCTCCCTTACATTTTTGTGG + Intergenic
1043771918 8:84213879-84213901 ATGTCACTCTTATAGTAATAAGG - Intronic
1044594107 8:93941716-93941738 TTATCTCCCTTACAATGTTAAGG - Intergenic
1045154487 8:99452023-99452045 ATGGCTTCCTTTCAGTCTTAGGG + Intronic
1045625605 8:104044767-104044789 ATGTCTCCCTTACAGTATTAGGG - Intronic
1047704128 8:127480660-127480682 ATGTCTCTTTAACAGTATTAAGG - Intergenic
1048003241 8:130396993-130397015 CTGTCTCCCTTATGGTATTTGGG + Intronic
1048638614 8:136327540-136327562 ATGCCTTCCTTATATTATTATGG - Intergenic
1049052098 8:140206570-140206592 ATTACTCCCTTACGGTCTTAAGG + Intronic
1050431216 9:5563805-5563827 ATTTCTACCTTACAGTCTTGAGG + Intronic
1051386729 9:16517386-16517408 ATATTTGCCTTACAGTATTAAGG + Intronic
1052725480 9:32223687-32223709 ATGGATCCCTAAGAGTATTACGG + Intergenic
1053892299 9:42705831-42705853 ATGTCTCCATTACAATGCTAAGG - Intergenic
1054732851 9:68718378-68718400 TTGTTTTCCTTACAGTATTTAGG - Intronic
1055114089 9:72588534-72588556 TTGGCTCCCTTACAGTATGGTGG + Intronic
1055858752 9:80723745-80723767 ATGACTGCCTTACGGTATTTTGG - Intergenic
1058054500 9:100435939-100435961 ATGTATGCATTACAGTATTCTGG + Intronic
1186549263 X:10485461-10485483 ATATTTCCCTTGCAGCATTAAGG - Intronic
1189910364 X:45804856-45804878 ATGTGTCCCTCACAATACTAAGG + Intergenic
1189944900 X:46168114-46168136 ATCTCTCCCTTACGTTATTCTGG + Intergenic
1191992353 X:67051873-67051895 ATGTATCCCCTACTATATTATGG - Intergenic
1197540576 X:127755134-127755156 ATGTGTCCCTTATTGTATTGAGG - Intergenic
1198477423 X:137009065-137009087 ATGTCTCCCTTCCACTAGAAGGG - Intergenic
1201913232 Y:19155032-19155054 ATGTCTCCTTTAAAGGAGTATGG + Intergenic