ID: 1045649525

View in Genome Browser
Species Human (GRCh38)
Location 8:104329015-104329037
Sequence ATGCTGTCTTGGGGCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045649525_1045649529 1 Left 1045649525 8:104329015-104329037 CCAGTTCTGCCCCAAGACAGCAT No data
Right 1045649529 8:104329039-104329061 ACAAATAAAAATTACAGAAGAGG No data
1045649525_1045649530 9 Left 1045649525 8:104329015-104329037 CCAGTTCTGCCCCAAGACAGCAT No data
Right 1045649530 8:104329047-104329069 AAATTACAGAAGAGGCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045649525 Original CRISPR ATGCTGTCTTGGGGCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr