ID: 1045652693

View in Genome Browser
Species Human (GRCh38)
Location 8:104356205-104356227
Sequence CGATGTGGCTGAGGAGTAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045652693_1045652699 7 Left 1045652693 8:104356205-104356227 CCGACTACTCCTCAGCCACATCG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1045652699 8:104356235-104356257 AATTCTCTTCAGGTCTAGGATGG 0: 1
1: 0
2: 1
3: 99
4: 501
1045652693_1045652698 3 Left 1045652693 8:104356205-104356227 CCGACTACTCCTCAGCCACATCG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1045652698 8:104356231-104356253 CAACAATTCTCTTCAGGTCTAGG 0: 1
1: 0
2: 0
3: 23
4: 147
1045652693_1045652696 -3 Left 1045652693 8:104356205-104356227 CCGACTACTCCTCAGCCACATCG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1045652696 8:104356225-104356247 TCGCACCAACAATTCTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 63
1045652693_1045652700 26 Left 1045652693 8:104356205-104356227 CCGACTACTCCTCAGCCACATCG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1045652700 8:104356254-104356276 ATGGCAGTCACTATTCATGCCGG 0: 1
1: 1
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045652693 Original CRISPR CGATGTGGCTGAGGAGTAGT CGG (reversed) Exonic
900163442 1:1235394-1235416 CCGTGTGGCTGAGGAAGAGTTGG - Intergenic
902104960 1:14027266-14027288 GCATGGGGCTGAGGAGCAGTGGG - Intergenic
903373297 1:22850551-22850573 CGATGTGCCCGAGGGGAAGTCGG - Intronic
904267376 1:29325619-29325641 CGATGTGGCCCTGGAGTACTTGG + Exonic
906038026 1:42765149-42765171 AGATGTGTGTGGGGAGTAGTAGG - Intronic
906446338 1:45902011-45902033 CTATGTGGAATAGGAGTAGTGGG + Intronic
907849021 1:58236127-58236149 CGAGGTAGGTGAGGAGGAGTGGG - Intronic
909051574 1:70774194-70774216 GGATGTGGCTGAAGACTGGTTGG + Intergenic
910128576 1:83874607-83874629 GGATGTGGATGTGGAGAAGTTGG - Intronic
912015380 1:105027662-105027684 CAATCTGACTGAGGAGTACTTGG + Intergenic
918597465 1:186308249-186308271 GGAGGTGTCTCAGGAGTAGTTGG - Exonic
920681248 1:208074441-208074463 CGAGCTGGCTGAGGAGCAGAAGG + Intronic
922672905 1:227526990-227527012 CTATGTGGGTGACTAGTAGTGGG + Intergenic
1063197900 10:3760101-3760123 CGATGTGACTGAGAAGTAAGGGG + Intergenic
1063982571 10:11466771-11466793 GTTTGTAGCTGAGGAGTAGTAGG - Intronic
1066494616 10:35930488-35930510 CGATGAGGCTGTGGAGAAATAGG - Intergenic
1067665452 10:48274151-48274173 CGATGTTGCTGAGGATTCATGGG - Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070826226 10:79391922-79391944 GGGTGTGGCTGAGGGGTGGTAGG - Intronic
1076088383 10:127656513-127656535 CAATGAGGCTGAGGAGGAGCAGG - Intergenic
1076172779 10:128336635-128336657 GGATGTGGGTGAGGAGGCGTTGG + Intergenic
1076732321 10:132444940-132444962 CCCTGTGGCTGAGGAGGAGCTGG - Intronic
1079884973 11:25976044-25976066 CTGTGGGGCTGAGGATTAGTGGG + Intergenic
1091598839 12:1904230-1904252 CGATGGGGTTGGGGAGAAGTGGG + Intronic
1095244933 12:39908588-39908610 GGATGTGGCTGAGGAGGATGAGG + Intronic
1101498065 12:105274774-105274796 CTATGGGGCTTAGGAGTAGAGGG + Intronic
1108026565 13:46184326-46184348 GGATGTGGCTGAGGGGGTGTGGG - Intronic
1112857432 13:103788210-103788232 TGGTGGGGCTGTGGAGTAGTGGG - Intergenic
1116454782 14:45106939-45106961 ACATGTGGATGAGGAGTATTTGG + Intronic
1119481095 14:74958390-74958412 CGATGTGGCTGGTCAATAGTGGG - Intergenic
1120859398 14:89241323-89241345 GGAAGTGGCTGAGTAGAAGTTGG - Intronic
1125644721 15:41262352-41262374 GGAGGTGGCTGAGGAGTCATTGG + Intronic
1128544217 15:68556393-68556415 GAATGTGGGTGAGGAGTTGTAGG - Intergenic
1131748064 15:95471601-95471623 CGATCTCGCTGGGGAGTAATGGG + Intergenic
1132657238 16:1046473-1046495 CGCTGTGGCTGAGCAGTGGCTGG - Intergenic
1138922425 16:61547997-61548019 AGATTTAGCTGAGGAGTACTTGG + Intergenic
1140151892 16:72375849-72375871 CAATGTGGCTGAAGAATTGTTGG + Intergenic
1141615615 16:85207903-85207925 CGATGTTGCTGGGGGGTAGCTGG + Intergenic
1142672650 17:1494214-1494236 AGAAGGGGCTGAGGAGAAGTGGG + Intergenic
1143680910 17:8475362-8475384 TGATGTGGCTGAGGAGTCGGGGG + Exonic
1143717507 17:8785530-8785552 GGATGGGGCTGAGGAGCAGGAGG + Intergenic
1146595220 17:34162529-34162551 CGATGGAGCTAAGGAGTACTTGG - Intronic
1152277627 17:79367352-79367374 GGATGTGGAGGAGGAGTAGGAGG - Intronic
1157276063 18:46311874-46311896 GGATGTGGCGGAGGAGGAGGAGG + Intergenic
1157442066 18:47719020-47719042 AGATGTGGATGAGGAGTGGTAGG - Intergenic
1160991783 19:1863174-1863196 CGAGGCGGCTGAGGAGGAGGAGG + Exonic
1161796051 19:6387393-6387415 CGAGGAGGCCGAGGAGGAGTGGG - Exonic
1167422407 19:49412035-49412057 CGATATGCTTGAGGAGTAGAGGG + Intronic
1167503266 19:49858859-49858881 TGATGTGGCAGAGGAGGAGCAGG - Intronic
925142463 2:1559436-1559458 CTCTGTGGCTGAGGAGGAGGGGG - Intergenic
925854030 2:8112077-8112099 ATATGGGGCTGAGGAGTAGGAGG + Intergenic
934950724 2:98573591-98573613 CGTGGTGGCTGAGGTGTGGTGGG - Intronic
935140192 2:100346136-100346158 AGGTGTGGATGAGGACTAGTAGG + Intergenic
937856629 2:126676746-126676768 AGATGTGGCAGAGGGGTGGTGGG + Intronic
938201403 2:129375749-129375771 GCATGTAGCTGAGGAGCAGTTGG + Intergenic
938781016 2:134584956-134584978 TGAAGTGTCTGTGGAGTAGTTGG - Intronic
939245814 2:139622139-139622161 TGATGAGGCTTAAGAGTAGTAGG - Intergenic
939645718 2:144696427-144696449 TGATGTGGAGGAGGAGCAGTTGG + Intergenic
940012057 2:149065031-149065053 CGATGTGTCTGAGGAGTGCATGG + Intronic
942627370 2:177916415-177916437 AGATGTGGCTGATTAGAAGTGGG - Intronic
948356745 2:237384374-237384396 CCATGTTGGTGAGGAGTAGCAGG - Intronic
948375645 2:237518664-237518686 CGAGGTGGCTGAGGAGGGGGTGG - Intronic
948707181 2:239802205-239802227 GGAATTGGCTGAGGAGTAGCAGG + Exonic
1169866997 20:10212546-10212568 CGGAGGTGCTGAGGAGTAGTTGG + Intergenic
1171030770 20:21674628-21674650 AGATGTGGCTGAGGGGCAGTGGG - Intergenic
1171952863 20:31437055-31437077 CAGCGTGGCTGAAGAGTAGTGGG + Intergenic
1172054809 20:32146749-32146771 CGGTGAGGATGAGGAGAAGTTGG - Intronic
1173429575 20:42974300-42974322 TGATGTGGCTTAGCTGTAGTTGG - Intronic
1175213072 20:57373789-57373811 GGAGGTGGCTGAGGAATTGTGGG + Intronic
1177633132 21:23752269-23752291 GGTTGTAGCTGAGGAGAAGTGGG - Intergenic
1178053198 21:28770209-28770231 GGATGTGGGTGAGGATTTGTGGG - Intergenic
1181417615 22:22771844-22771866 CGAGGAGGCTGAGGAGGAGAGGG - Intronic
949787713 3:7759859-7759881 GGAAGTGACTGAGGAGTACTTGG + Intergenic
950143544 3:10632076-10632098 CTCTGTGCCTGAGGAGCAGTGGG + Intronic
950717808 3:14862162-14862184 GGATGTGGAGGAGGAGTGGTAGG + Intronic
950995319 3:17489979-17490001 TGATGAGGCTGTGGAGAAGTAGG - Intronic
953831380 3:46300484-46300506 AGATGTGGATGAGGAGGGGTGGG + Intergenic
959085842 3:101849831-101849853 CGACGAGGCAGAGGAGAAGTCGG - Exonic
962317446 3:134367620-134367642 CGAGGTGGCTGAGGAGGCCTGGG + Exonic
963788118 3:149556060-149556082 CCATGTGGCTGAGGAGCAGAGGG + Intronic
967818234 3:193816846-193816868 GGATGTGGGTGAGGAGTGGGAGG - Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
972729457 4:41779336-41779358 AGAAGAGGATGAGGAGTAGTTGG - Intergenic
973247016 4:48019828-48019850 AGATGTGGCTAAAGAGTAGGTGG - Intronic
974025172 4:56727271-56727293 AGATGAGGCTGAGAAGTAGCCGG + Intergenic
975757507 4:77585446-77585468 CGATGTGGCTGAGGACGTTTAGG - Intronic
977317431 4:95467978-95468000 TCATGTGGCTGAGGAGCAGGAGG + Intronic
978271211 4:106893031-106893053 CCATGGGGCTGAGGAGCAGATGG + Intergenic
980161226 4:129165279-129165301 ACATGTGGCTTTGGAGTAGTTGG + Intergenic
984766523 4:183404481-183404503 GGATACGGGTGAGGAGTAGTGGG - Intergenic
987066816 5:14297854-14297876 CACTGTGGCTGAGGAGGAGCTGG - Intronic
990528308 5:56650259-56650281 GGATGCGGCGGAGGAGAAGTCGG + Intergenic
996693077 5:126361823-126361845 CACTGTGGCTGTGGAGGAGTTGG + Intronic
997896414 5:137721845-137721867 AGATGTTGCTCAGGAGTTGTTGG - Intronic
1004339263 6:14793996-14794018 TGAGTTGGCTGAGGAGGAGTGGG - Intergenic
1004416976 6:15433686-15433708 TGATGTGGGTGGGCAGTAGTGGG - Intronic
1008254904 6:49285885-49285907 GGATGTGGATGAGGAGAAATAGG - Intergenic
1014058853 6:117047984-117048006 AGATGTGGCTCTGGAGTAGATGG - Intergenic
1018375551 6:163207942-163207964 GGATGTCGCTGAGAAGGAGTGGG + Intronic
1018596142 6:165482853-165482875 CCGTGTGTCTGAGGAGTTGTGGG + Intronic
1019201947 6:170324227-170324249 TGATGGGGCTCAGGGGTAGTGGG + Intronic
1021964008 7:25899865-25899887 CCATGTGGATGAGGAGAAGCAGG - Intergenic
1022184355 7:27952590-27952612 CAAAGTGGCTGAGCTGTAGTTGG + Intronic
1037378505 8:18258890-18258912 TGGGGTGGCTGAGGAGTGGTGGG + Intergenic
1037635905 8:20700888-20700910 CCATGTGGCTGGGAAGCAGTTGG + Intergenic
1038057738 8:23876934-23876956 AGATATGCCTGAGGAGCAGTTGG + Intergenic
1045652693 8:104356205-104356227 CGATGTGGCTGAGGAGTAGTCGG - Exonic
1047325761 8:123834494-123834516 GGATGTGGCTGGAGAGGAGTCGG + Intergenic
1048961810 8:139586002-139586024 CCATGTGGCTGAGGCATAGTTGG - Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049779944 8:144424336-144424358 AGCTGTGGCTGAGGAGGGGTTGG - Intronic
1057448540 9:95136770-95136792 GGTTGTGTCTGGGGAGTAGTGGG - Intronic
1058060338 9:100489067-100489089 GGATGGGGGTGTGGAGTAGTGGG - Intronic
1060894765 9:127210544-127210566 CGAGGAGGCTGGGGAGGAGTTGG + Intronic
1061419266 9:130464420-130464442 GGATGTGGCTGAAGAGTGGCAGG - Intronic
1062512788 9:136916703-136916725 AGAGGTGGCTGAGGAGCAGCTGG - Intronic
1187996855 X:24936043-24936065 CAGTGTGGGTGAGGAGCAGTAGG - Intronic
1190265260 X:48824225-48824247 CGATGTAGCTGAGGACCAGCGGG - Exonic
1190267198 X:48834384-48834406 CGGGGTGACTGAGGAGTGGTGGG - Intronic
1190329394 X:49226434-49226456 CGATGAGGATGAGGAGGAGGGGG - Exonic
1191223437 X:58015652-58015674 CCAGGTGGCTGAGCAGTAATGGG + Intergenic
1195250445 X:103039281-103039303 CGGTGAGGCTGTGGAGTAATAGG + Intergenic